Description :
From Genome Similarity Track
Location :
scaffold_54:38890- 46861
Transcript NameFunction/comments
Pl_110992hypothetical protein PHYSODRAFT_509290
Pl_110993heme peroxidase
Pl_110994hypothetical protein PHYSODRAFT_505107

Sequence
7971 bases(100 bases per row)
ATGCTGCATCTCATCGGACATCTTCTCAGTTGGTAGTTTTCTGGTATTCACTGAGGCACAACTGGAATCAAAAAGAGGATCGAGCATCAAGCAATACGCT
GGATCCTTATTTTGTTGTTTCGTCGTCGACTTGGGTCTTGTGAAGACGTAGTGGTGGTGATTCTGCGGCGACTCAGAGGAAGGTCGCGGTTTGTTGTTCC
CAGCAGGTCTCGTCGATGCAATGTTGACTCCATTCAAGCTTACGGGGGATTTAAAGCCACTTTCGAGAACAAGTATGGATGGAGTGTTGTGCGGCAGCGA
CTCCATGGTAGTAGAACCAGCAACTCCTATCGCCTTCCGAGTTACGGGAGATGATCGAGCTCCGGTACTATCATTTACACGAGCTAGTGGAGATGTCGGT
AGAGTTGGAAATGAAGCACAGGTTTGAGGTTGGTTCCTCAGGATTGGGCTAGCCATTGTTGATCTACTCGAGTGCTCGCTCTTCGATCCGACACCACTAA
ACACACTTGATTTGCGACGTTGTTCCTGTTGTCGCTCTAGATACTGCTGATGTTCATTTATGAAAGCCATTGTCTCGCGAGCAAGTTCGCCAACAGATTT
TTTATCTCGTAAAGCCATGGGTTTGTTTTTCAACTCCATCGCGAAATCAAAGCCGATCTGCTTCACTCTCTCCATCAACAACGTCGATGGAGCTGTAACG
CTATCAGCTTTGCTGCCCAACTTCTTTTTAGCATCATTCGAAGGAGCTTGGTCAACGATACCCTTAGTGTTTATCAGATACGTATGGAATTCACCGAACG
GATAGGACGCAATAGATCGGATAATTGTCATTGCATCGTATTGGAGTGACTCGAGATGAGGATTTGGACTCCCTTCTAGTCGAAGACGCGTGAGGAATGG
GAAAAGCAAATGGACAATATCAAGTGCCACCACGCGGGGTACGCACACTAGCACATCTTGGCTTAGCGCTGCAATAGCACCAACAGCGTGAACCAAAAGC
CTCCATCGTTTGATCTCATCTTTCTTTTTTGACGAAGATGACGCTGAGCCTTGAGTGAATACAAGATCTCGATGCTGCTGCAGAACCTTCGTAAGCAGCT
CCAGTACTCTAAAATGTATAAAGAGTTCTCCTGTGCTTCCTTCCACCGCATTCACCATGGCAAGTCGCGAAATAACAACAGCAATCTCGCTTTTGCATTC
ATCATCAAGAGTTCGATGAGTTGGGTGCCGCATTTGCATCCGCTTAAGAAGGTGCGGTAGAACCTGAGCACGCATTATCCCAGTGTCGCATTTGCATCCG
CTTAAGAAGGCGCGGTAGAACCTGAGCACGCATTATCCCAGCCCGTCCATCTGCAACTGCACAAAGCTTACCGAAAAGTGTATATAGTGCAGCGGGTACG
TCTAGAAATTCATGATCATCAACAGATGAATCAAACTCAACGCTTTGACGCTTTGGAGAAACTTGCCCAGTTCCAGTCGCGATCAGAACCTCGGGCAAGT
GAATCAACGCTGTCTGCAAACAACCTTGAGTAAGTAGCAAACTGCATGCAGCGTTGGTACACGCTAATCGGCTCAAAGCTACGCAGCACGCACTGACAAG
GTGTACACCGGCATTTTTCTCGCGAAGAATGTTCAAAATTGCTGGAGCGATCAGCTCAACAAGCTTCAATAATTTTTCTTGGGCATATTTTCCGTGTGGA
TGGCTTGCATGTGACTTCAGAAACTTGTTGCGAGCAATTTCACCGTAAGGTAGTGGTCGAATATACCCTGCCAGTTCTACTGCAGCAACAACCTTGTTCA
GTTCTACCTCAGCAAATTCGACTGCATCACTTGGATTTCGGATGAGCGCAGTCAAGTCTTCTAGCACGTGCATCCGAAAGATGACATCACAAATCAAAGC
TTGGGGCCATTCCGGCACTTGGGGAGATGTGATAGATGGGCGAAGCCGTGCATCCACCATATTACTTGGACATCGTGCCAACCGGCTAAGCGCCTTGCAG
GCCTCTTTGGAGCCAAGCTCATGGACGAAATGATCTTCTGATGAGCTGCGCGCCACCAAACCCTCAATTTCGTCCAAGCGGTTGCACTGAATTGAAAGCG
CAAGGTGATTGACAATGTCCTCGGAGAAGCACGCTCGCATCACGTGGGTGACCTTGCACAATCGACCTAGCAAAATGCAACTGATGTTGCGCTGTCGAGA
ATTCTGCACAGGTGATTCCATACAACTTGGAGAGACTTGAGTCACAAACTTCACCAAAGTTGGTAGTGCATTGGCCGAGAAAAAATACTCGGCTGTCTTC
TCCGATGCACGCGGTGAAGTTTCATCTTCCAACATCAGGTCCAATACGAGTGTGTACAATGCATCTAGTCGATCCTCGACGTTGGCTAGCGCTGCAAGTA
ACGCTGTGGCTGGCTTCAACTGCTCCGTTTGTCTAGCCAAGAGAGCGCAGCCTATGAGCCCCATTACGAACGTCATACGCGATTCACAGGATTCAAAGCT
TGGTTGACACCAACGGATAAATATTTGTGTAGCACCTGCTGTAGTGAGCCCGTGTCGGGCGTCTGTGCGGCTGGTTAATTCGTAAAATAAGGTTACCGAG
GCTTGAACCACAACCAAGTTTGCGCCTTTCATGCATAATAGAACTTGCTCAAGCCATTGACCTCCACATCGAGTAAGCGCATCAAGTAGCTGAGAAAACC
CAATCGATCGTGCAAGCAGACACAGAATTTCCAGTACTTGTGCGCGCTTTGTGTCATCATGATCTCGACAATAACGAAGAACTTCAAATAACGTGTCAAA
GACATCTGTAGTTAGCAGGAAATTACGCACTGACACCTTTAGCTTTCGCAGCAAGAAGTTCCGCTCCTCTAGACTTTCAGTGCGCGTATGATCTTTCGCA
GGCGAGAGTGCTCGTTTTCGAGTTGGGCTTTCTGGAGTAGCTGAAGACATAACCTGTTGGCCCCATCGTTGTGTCGCTTGAAGAACTTTGCTGGCTATGA
CGTACAACAAATTGAGCGAGCTTGAAAGTACAGGGGTACCAGCACACGTTTGCATCGTGTGAGTTAAGTCCAATTGCACTCTCTGCACGATATTACATTG
AAGGATTTCCACAATCTGCTCGTCCCCATGACCTTCGATGATACTTGAAAAAATTCCTTTCACATGCTCAGTCACTTCGCGACTCTGGTGTCTTGTGACT
AGCGATGCCAAGCATACTAGCAAACCGGATCCAAGTACACGTCTCTGATCTGCTAGCACGGTGCTGCGGGTTTTATCCGATATGGATTCGGGCCCACGTC
GCAGCTTTATCAAATGATACAATATGGTGATGTATGCCTGCGTAACGCTGCTGGGGATTCCTCCTGGTCCAACAGCTTCTCGGAACACCTTGAATTGGTG
ACGCAGCTCAACAAATTTTATCATATGCATGGAGCGAAGACGAGTTCGGACAATAGGGTCACAGTCGCGCTGGATCAGTGTACGCTCGAAAAGTACTCTA
CGCCAGTGATGTTGGAGAATGCGTGCACACAATTCGGTTTCGCGCAGCAAACACCCGATGCTTTTGTTCACAGCATTTTCGTTTGATAGGACATGCGCAA
ACCACTCGGCTAGCACTGCAACAAGTCGAGCCATACGGAAGATCATGGTATTGTTTGTGTGTTTGGAAAGTGTCCGGAATGCCTTGTTGGTCAGACTTGG
TAAGGAAGTCTCCACATAGTCTACTGCATCTAACGAAGTAAACACGAAAGATGAGCCAAAAACTACAACATCATTTGTAGTGTTTGTAGCCCACATTGAT
CAACGTACCGACCTTCATGAGTCTCCATCAGACGGAGTAGCATCGTCGTAGCAAGCTCGCGACGTGAATCATCCTCGGAATATTCAATCGCTTCGTACAG
AGTCTCTACAGCAGTCTGGATCTTGGTTGTGTTCCACGCTCGCGTATCCCATTCTTGATCCATTAGCATTGTTGCCTAGACACCGCAAGGATTACATCAA
TATCACTAGCCAACACCACCAGGTTCACTTACAATTCGGCCTTCTGCCACAACAGGATCTTCATCCACTTCCACTCGATCTGGTTCACCTGTATCCTCTT
CATCCAAGTCCGGCGCAACTTCAGGAAATCGACTTGGAATCACACGCTTCGGCGACTGCTTTGGACTTAGCTGCGTTCCATTTTGCTTTCGTGCTCTCTT
CGTCGTGTCACGAAGGATCAGAACACGACGTCCAACATCCTGAAGGTGCTCGCTCGCTGCAGGATCTAGTGGTCGATCAAGCGCTAACGTTGGTATCAAT
TGTTCTTGCATCGCATACACACGCTTAGCCTCCGCATTAACATCCATTGTTCGGTCTATCGTCGAGCCACGTTCATCTTCCCATGGGTAAGCCTTCTCAT
ACGGCAAAGTCACATCACGCCGGCCACGGCGAGAAGCACTATCGTTCATGATGACTAATGACTGCTAAGTCACGATCGAAATAGGAGCTAGCTATCATGA
CAATGTAGGTTAGGAATGCAGTTTCATCGTGATGGTGTATTGTTTACATACTTAGACGCTTGCGAGCAGTTCCTGGATGCCCAGCATGCTCATCTGACGT
TGTTTGGTGCACCTGAGTCTTGAAGCGGGTAACACAAGGAGGTTCCATTCCTCAAAGGCGACTACTTAACCATTTACTTGCCGCCGAAGAACTTGCGCCA
TCCCGAAGTCTCTGGGAACTTGACACCGTTCTCCGTAAGCTTCACAAAAGCCTTCGAGAAGTCCTTGAACCACAGCTCCTCGTCCTCGGCGTACATCTCA
ACGTACTTCTTGAACTTGGGGTCCTGGATCAGCACCATGTCGGCCGGTAGCATCATAAGCTTGCCCGTAGGGTCCTCGTACTGCGTGGGTCCGTTCCACT
TCTTAATGGTCCACTTGTTCTCAATAAGTTCACGGAAGAACTCGTTCGAGAACGTCCACTCTGCGTTGGTCCATGGGCCGCTGTAGCCGCTACGTGTGGG
GTAGCAGCGGCCAATAGCATGAGCTCCCACGAGCGCAACAATGTCGCGGTCGTCGAATCCCATGCGGTAGAAGACGTCGCGCACGTGCTGCGTGGTCTTG
TCCTTGCTGCCCATGTCAGCGTTAGGCAGACGATCGTCCGGCGTCTGCGTGGGTTCCTTGCCGCTCTTGGCGTCAGGACGTCCAAGACGGAAGGGGATTT
CGGGGCCTCCCATCTCTTCAATCATCGTCACACCCGCCAGCACGTACAGGTCAGCGTATGTGATCTCCGGGTGGTTCTTTTTAACCTTCTCTAGAGCCTT
CACAGCCAGGTGCAAACCAGCATTACCGCCGTGGTTAATCTCCGGATCAAAGCGGATAGTGCCGCCAGTGGAGCCGCCGCTGTGGTCTTTCGATTTGTAC
GTGCCGGACGAGTGCCACGCGAGACGTAGGAGCGTGGGGCCCATGTAGTTGTCGTCGTCGAAGATCTCGATGATCTCCTTCTTGATGGCGTCGAGGTCCA
CAGGCTTCTCACGAGCGTTCACGAGGTCCGTGAGGGCCAAGCCGCTCACAGCAGCAACACCGGCAGCCGCGAGTACGATGGCGCTTGGTTGCTTCTTCTT
GCTGGCGGTGCGAAGCTGCGACGTGGCGAAGTTGCGCGTCTTGGCGGCGGAGGCGGCGGACGCCTGCTGGGCGGCACGGAGAGCAGCGCGACGGAGCATT
GAGACTTGGAGATTCGCTTGAGCTCTAGGCGGAAGATTCGAGAGTGAGAGCGTCGACGGGAAAAGATCGAAAGAGGTCGGACATTGGGGAGGGATTTCCA
AGTGACTTGGATAAAGTATGGAGGGCCGAGGAATCAAACGAGATAGTGCACCAACGGATTCCGTGGGTCCAGTCAACAAGGAGGCAACTTGGGATCAGAG
GCTCGGGTGCTGGTCGGTGCACTAGTATGTCGAGGAGAGATGTTAACCATGAGAGTTTGAAGTCTGCTAGAGGGTGGCATTGCTTTTTTGCATTGTTTCA
TATGACGCTCAGTGTACTACCGTAGTACTACTGTGTTCACACAGTTCACGCTTGCAATGCATACTTTAGTCGTAGACTACAACGTGTAGTACACGTTCAT
GCACTATGTAGTACTACGGAGTTTGTACAATATTTGACTACCAATTCGAGTGTGTATCTTTTCAAATCTGATCACTTCAACCTGAGCTTCAAGTGCGTGG
TGGGTTTTCACCAAATACCAATGTGGTAGGACATACTACTACTAGCAGCTTGGTAGGACACAGCTGCTGTCTTCTCTGCAACCTTCCTCTAGTTCAGTGC
CAACTTTGCGGAAGGGCCCCAAGAAGCGTGTTGAGACCCAATCCTAGATTGACATTTCGAGCAGGATGCTGTGGCGAGACAAGACAAGCTTCGTTCGCAT
AAGCCTGAAACGTCGATAAGCTCAATGACGTGTACCAGGTTGGGCACCAGTTCAAAGCTTGCTACGTTCCTGCTCTCATGACGTTACTTGCAAGATGGTA
ACTAGGATAGCAACAGTACTACACCGTAACGGAACTAACGGTTCCACCAACAATCGTGAGCGTGATGATGTCGTCCACGGAGAGCTGTAAGATGATCTTC
GTGCCCGTCGACGCTCTGAAAACTGTCGTGCATGGCGCTCGCGAGCAGACACAGGAGAAGCAACGTCTTCTAGCGCGGATCGAGGAGAGTCGCAAGCGCG
TTCAGTTGCTTCGTAGTAGATCAGCGGCGGTGGAATCAAGGCTGATGGAACATCGCCAAAGCACGATCGAACACAGTAGCAATGCTGTTGTATCGCCCAA
GGTTGGACCCAAAAGCGAGACCAGTCCATTGGTGTGGCCATCTCCAAACGGAGCAGGACCAACAGATCAAACTTCAGGCGGCATCGTTACGATGCAAAAG
CGTGTTTCGCAGCTGGAGACGTTGATGACCCTAGCGAAGGAGGTCTCCGCTCAAAGTAGCTTTGACAATATTATCGAGCGAACATTGCGAGCATCACTGC
AGTTGGTGCGAGCCGACAAGTTCACTTTGGGTATTCTGCACGAGCGACGGAACGTCCTGGACGTATTTTCCATCCTACGCAACGATGCCGACGCCGACCA
GGATTTGTCGTTCATGAAGGTAAATGTTATCAATGAAGGCTTCGTGGTGCCTGACTCCCCCACAGTTTTTGGACGTGTGATCATGACCGGCCGGCCATTC
GCGATCAACGACTCGGACACACATGAGATTTTCCAAAGCCAGCGAAACAAGACGGACAACAATGATGGAGGCTCCTCACAAGCATTACTATGTCTACCAA
TTCGCAATGCTCACCACGCTGTGGTTGGTGTTCTACAAGTGGTGGTCACTACGAGCAAGTCATCGTCGTCAATTGCTTCTGCCTCAACAGACAAATCCAC
TCCAACCCCGACATCCTTCACCGACACCGATATCGCCAATCTGGAGTTTATCTCCATTGTGGCAGGTGCTACAATCTGGAATCTAATGCTTTCACGCCAG
CGGCAGACTGCCCAGCATCGCATCGAAGGGCTACTCAAACTGCACCGCAACATCTCCATGGAGAGCGTCTCGTTGTCTGCCGTACTAGACCAGGTGCTAG
CCGTTTGTCACGAACTTGTAGGCACGGAGCGGATCGGTTTATTTATCAAAATTGATGGCGAGGACGAGCTTTACATTGCATCTGCTGCAGATATCGTGAG
AGGAGAATACGTGCCGATTACCAAAGGTATCGCTGGATATGTTGCTCGTACGGGTGATACTGTCATCACGAATGATGCATACTCACATCCGCTATTCGAC
CCGACATTGGACCAGAAGACAGGTTTTCTTACCAAACGTATTCTGTGTCTACCTGTTAAGTCTCCTGAGGGAACCATCCTAGCAGTGCTCTCTGCAGTGA
ATAAGGTTGATGGGATGGACTTCACTAGCGAGGACGCTGTTTTCCTCAATTATGCAGCTGAAGCTGTGGGA