Description :
From Genome Similarity Track
Location :
Scaffold_1181:3889- 7041
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1181-snap-gene-0.4Lysosomal alpha-mannosidase

Sequence
3152 bases(100 bases per row)
CTTGAAACAGAGGCGGAAGCTGCGCACTTCCATCGCCTGGAGCTCCACTTCCATGCCCCTGAGCGCAATCGAAGGCTTGCTGATGTCAGCTTCGACGTCG
ATTGTCTTCCATTTCATACCGTGAGGCTCGCGCTCCTGGCTGCTCAGTGGCGCGACGCCAGTCAGGAGGAGTTCAGTTACTTCGCTGACTGCAGAGTTCT
TGGCAGCGAAGAACTTCGAAAAGTCCAACTTCACAGACTTGGAGAGTTCGGGATGCTCCTCGATAGAGTACAAGTGGGTGAGACGCACCATGACGCAGGC
TTTGCTGAGCTCCTGAAGCGTCGTCAAGCCCACGTTCTCCGGAAATTGGCTGATCGTCAGCCATGGCACCTTCACTTGGGCCTTGGCGTCTGCTGCCACT
GGCTTGCGGAACGCCACCAGCGGAGCGAAGAACTGCTTTTCCATCTTGGCTCGCAGACTGCGGATGCCTTCCGTAACGAGGTCGACGTTGATGAAAAAGC
TGCCGCGAACAACCAATCCCCTCTCTGTCTCCTTCTGCGTGACCTTGTCAATGAACGTCTCGGTCTCGTTCAGGAATTCGCCTACGCCCTTGCCATCGTC
AGCGAGCAGTCGGCGGTGCACCATGATTTCGATCTGGCCATCTTCCAGACTCGCAGCTCCTTGCGCGCGGTCCGTAACGATGTTGAGCTGGTACTTGTTG
TCCTTGATGTACGCGCCAGTGGTGATCGGGAAGTAGTTCGCAGCGACGAACTCCTGGTCGTCGTGAAGCGTCAAGTTCCACGTGTCACGGTGGTTGCGCA
CGCGCGTGATGAACTCGAGCCCGTTCGAGTCCGTAAACAGCGTCTTCGCAGACTTGATGCTGCTCTGCGAGTCAAAGCGGATGATCACCTCTTTGCCCTG
CTTGTCGTCGATGGGGACCGATCCAACCGTCCACTCGACCTCGACAAACTCGTCACCATCATTCACGCGGTACTCCAACGTGACCCAGCTGCCAATCTGG
AACGCGACGCGAGACGAATCGCCACCACCAGACGCTGAGTTCACGTGAAGGTCAATAAGACGCACGTCGTCTGCTTTCCCCGCAGGATACGTGATCTTTG
AGTCGGGTCGGAAAATATATGCGCCCGAGTGCTTCTCGTTGTCGGCCTGGAATGCCTGGTAGTACAAGACGCTCGAGGTCAGCGGCAGCTCGACGCTACT
CGCCTTGTTCGTGATTGAGATGATCGAGCCCGTGTCTTTGGCGATCTTGACGCTCACCAGATCGTTCTCGAGCGTGACCACGGCGTCATTCGTGCTCTTG
GGTGGCGATGTAGAAGTAGTACGCTGCGCTTTCTTCGACACCAGGAAGCGGGCATCGCTCATGGGATCCAGTTCCGTGCTGAAGACAAGAGAGTACACAG
CCCCCTTCTGGTCTGGATGCACTGGGACTGCGGCGAAGACGTCGTGCTTGCGCACTTTTGCATTGCCCGAGAGCACTTGGATAGTGACGTCCGTGTGCTC
GATAGGGACCGAAATCGTCTGTACGCTCTTCCGCGCCAGCGCATTGTGCACTAGCACTTCGAAGTTCTACAACAGTATCAAAGCACACTCAGGTGTTAGA
ATTCACAACAGTTACAGCTCAGCCAAACACAAAAGATTACCTCGTTTGAAGTGGACACGTCGCAGGTGCTAATGTTCGCGAGCAGGCAGAACTCGTACGG
TTCCTTCTCACCGATCACGAAGAACACCTCGTTGAGCTCCTTCTGCGCCTCGAGGATTCCGTCGTTCAGGCGAAGCGAGTAGTCGTCAGAGACGCTCTGC
TTCTCCGTGCCCGAGAGACCGTCGTGGTGCTGCACAAGGCCAACTGCTCGCTGGAGCTTGTCGAGCTGCGCCGAGTGGTGGCTCTGGTAGAGCGCATCGA
GCTGACGCATCTGCTGAAGTAGCATGTTCCCCATCCGCGCGAATCGCTTCAGAGCAGGACGGCTCGTGAAGAAGCCCGACCAGTAATCATGTTTGTCCGA
CGCGTACGGGAAGAAATCGTCCGTCTTGACGCTCCACGTGAGGTTTTCAGCCAGCTTCAGGTCCGTGTAGTACGANNNNNNNNNNAGTTGGAGTAGAGCA
CCGAGACCTGGTCGTCTTGGTTCACATAGTGCTGCAATTTTTTCACCATACACATCACAATGTTAACCAGTCACTTTCCACAAACAAAACAATGGTATCA
AAACGCACCAGCAGCTTGTCCATGTTCTTGTACCACATGCGCGCGTTGTCGTACTGGAAGTCGCCGCCCATGGGGATGAAGATGTGGTTGCCCTTCGTGC
TCGCACCTCGGTCCTTGGCCATCTTGACGAAGTCACCCACCACTGTGCATACATTAAAGTCGTGTAGCTCTGGGTCGTCCTGGATCTGCCTCTCACGGAA
CCCGTAATCGAACTCCTGCGGAGGGCCGTAGTGGTCGATGATCTCGCCCGTGAACACTTGCGAGTGCTTGCCACGCGACTTGCTTGATTTCCAGATGAAC
TCGAGGTCTTTGTCCGCCTTGCGCTTGGCGTAGTCCTGGTAGTCGATGCGCGCAAAGTAGAGCGCGTCGAAGCCCACGCCAGCCGAGAGCAGGGACCCCT
GCGTGGCCGAGTGGCCGAACGGGTCGATCTGCCAGCCGATGCGGGGCGTGATGTTGAACTGGTCCTTGAGCAGCTGATGGCCGTACGCGGTCTGGTCGAC
CATCGCAGTGTAGTGCGGCGTGGCCTCGTCGTGCATGCACCAGCCGCCGTTCACGCTCAGGTCGAGCTGGCCGCTCTTCACGAGCTGCTTGACCGTCTTC
TTGGTCGCCTCGCTCTGCTCTTTCCACCAGCGCTGGAAGAACGACTGCTCAACGAACATGAACTGCCGATCGCGGTTCTCCAAGAGCTCTTTTAGCACAG
TGTCCAGCGTGTACTGCACGCGCTCCATAAAGTACTGATCAATGCCCACGAGCCAGCCTCTATCACACGCATACACAGCATGTTAGCATACTAACTACAC
CAAGCGCCCAGCATCACAAGACGCTCTTGTAAACACACGTACGGGTCATCGTGCGAGTGCGCAATGAGGTGTACGTTGAGCTTGAGCGGGTCGACCGAGC
CGCTCGTGTTGTACGTGCCGTCGACCGGCAGCTGCCACTTGCTGGGGTCGCA