Description :
From Genome Similarity Track
Location :
Scaffold_815:3889- 4975
Sequence
1086 bases(100 bases per row)
CGAACGTCTCGCCGTGCTTGGCATCGGCGGTGCTGCGGTCGTGTACCTTGTGCGCGAGCGCACGTCCCAACAGCTCTATGCGATGAAAGTGCAATCGTGT
CCGATGCAACAGCCGTGGCCGCGACGCACCTTCCACGCGCGGAAAGAACAGTACATTCTGCAAATGCTGCGCCACCCGTTCGTGTGCCGACTCCACGAGG
CGTTCCATGATAGCCAGAGACTGTACCTAGTGCTCGAGTACCACCAGGGCGGGAACTTGGCCGACGTGCAGGCATTTTGCGGCGGCACACTGTCCGAGCA
AGCCGTCCAGCAGTACGCATCGGAGATCGTGCAAGCGCTCGAGTACGTGCACACCATGGGATTTGTCTATCGCGACCTCAAGCTGCAGAACGTGCTCGTG
GCGTCCGACGGCCATATCAGATTGACCGACTTCGGTGTCGCCCACGAGGGCCTGCCCGTGGACCCGTCAAGATACTACACGTTGGAGAACAGCTCGAAAT
GGATTGGAGATCTCAGAGAGAAGGTAGCGACAACAGCAACGGCCACCACGGTATCAACGTCCGAAGAGGAGCCCGGTCAAATTGAAGAAGACGATCTCGG
CACGCCCGGAACCGACCACATGAACCCAGATGACCAAGATGTGTGGGAAACGGATTCTTCCAGTGGAGTTGCTGGTCCCTCCTCACATATGCTTGGGATC
GACGACCGTGTGCGGGTCCGCTCCAACTCGTTCGTGGGGACTATCGAGTATATGCCGCCCGAGATGATCCAGCAGGCATGGACCCAGTCGTCCGACGTCG
ACTGGTGGGGGCTGGGCTGCCTCTTGTACGAGCTTCTCTACGGTGTGTCGCCATTTAAGAAACCAAACGAGAACTCGACGAAACCGCTTTTCTGCCGCAT
CCTTCTAGGCAAGCTCGCCTTCCCAGCGTCCCCGCGAGTGAGCGGCCCGTGCAAGGACCTCATTCGTCGCCTCCTAAGTGTTGACGCTCGCAAGAGGCTT
GGGCACCGCCGCGGTTCGACTGAGGTGAAAGCCCACAAATTTTTCCGTGGTGTCTCGTGGGCCTTTCACAGCCGTGAGCCTCCCGT