Description :
From Genome Similarity Track
Location :
Scaffold_6:388785- 391054
Sequence
2269 bases(100 bases per row)
GCAAGCCGTGGTGCCTGAATATAAGATCGACAAAGATCTTCGCGGTCGTCTCTGCCGTAATGTGCGTGGAGACCGTAGTAAAGTGCACCATTTTGCTAAA
TCGATCCACAAGAACCAATATGCCCGTGCGTTTCTGTTCATATGGTGGAAGGCCAAAGATAAAATCCATGCTGAATGAGCGCCAGGCTTCCGTGGCAAAC
GGAAGCGGTTGCAATGGGGCATGTGAAGACGGCGCAGGCTTCACACGCTAGAATTTTTCACAAGAGCGTACTTATTTCTGGATGTACTTCTATATGGGCG
GCCAGAAAAACACACGACAAATAGCCGCGAACGTCTTTCGCGACCCAGATGATCACCAGCTGGAGTGTCATGAAATTCATGCATCAATCGTGCACGGAGG
TGTTCATCAGCAGGGATGACGACGCGCGATGGTTCAAAGACGCCCATCGTGTACGTCAGCAGCGTATCATCAAGATCGTAACGCTTGATGATGTCGCGCG
TTGATTTCGTCAACTTCGCGAGTGACTCTCATTAGGGTGTCGAAGGTAATTGAAAATTCCCTTTTAGAAAGAATCATTCGCATATGACTCATCGATCTGA
GTCCGAATTTACAGCACAGGTGTAGAAATCATTACATTGAGCCCCAGCTTAGCCCAGCGTAAACAAATGTCATCGTCTTCGTTATCAGCACTACCAGGCT
AATGATCTATTTCACGTCGATAATTATAATCAGGACGTCGAGAAAGCGCGTCAGAAAGAATATTATTCTTGCCGGGCTTATAAAATACCACGAAATTATA
CTCTGAGAAGTATGACAACCAGCATGTCATACGCTGGGACAAATGAGGAGTCTTGACAGCGTTACGCAATGATACGTGATCTGTGTAGACCGATAACATC
TTCTCGCGGAGCAAGTATACTCTGAACCTTAATCAGTGGGTAACGCCTGACCAAAAGCTCCTTGTCATGTACCGGGTAATTTATTTCTGCAGGTTTCATC
TGTCGTGAGTTTTCGTGCATGAGGGCACATCCGATTGCGAAATTACTCGCATCGCAGACGACGTGAAATGACTTCGATTCATCGGGCAACATTAGCACTG
GTGCCTCAGATAATCACGTTTTCACGGAGTCGAAGGCAGACTGATGTTCTTCCTTCCATGATCAAACTGCGTCTTTCTTCAGCAGTGTCGATAGTGGCTG
GATTAGCTCGGTATAGTTTTTCGTATACTTATGCTAGTAATTAGCCAAGCTAAGCCGTTGAAGTACTTCCGTTTGGTTCCTGGGAGTAGGCCAGGAACAT
ATCGACGACACTTTCTCGGGATCAGCACGGAGAACTACCTTGCTAACATAGCATCCGAGTACTGGGATCTCGGGAGCACAGAAGACAAACTTTTTCAAGT
TTGCGTATAATTTGTTCTCGCGCATACCTTAAAACACCTGATTAAAGGGCTGAAGGTGGATCTCCCACGTAGCTCGGTGAATAATTGCGTAACGGACGAA
GGACTTGTGTCACCATCTTGTTGAACGTGGCTGGAGCGTTCTTAAGGCCTTATGGCATAACTAGCCACTCCCAAATCATCCCACTGAGGTGCTGACCACA
GTGAATGAAATATCACTGTCCCTAATCTGATAAAAACCATCTGTCATATCGATGGCACTGAAAAATTCGCTGCCGGACATGGTATCCAATACCATGTCTT
TGCGTGAAATCGGCGTTTGGGCCAGGATCGTGGCGTGATTCAACTTGTTATAAGCATGCACAATGCGCCAACCGCCCGTGGCTTTCTTCACACAGAAATT
CGGACTCAAATATGGCGAGATACTCTCGCGAACATGGCCTGCCTTACGACGGCCCTAAAACAATTCATCAGTTGCGATGACTTAGTCACGAGGTAAAATC
CACTGGCGCGTCACGCAATACTTCGATCCTGACACGAGATCAATCTCGTGCCGCACTCCACGATCCGCTGGAAACTCAGCGGGAATTTCTCCGGAAAGAT
ATCGGCATACTCGCGGGCGTTATCTTAGACGGGGTTGCCCGAAGCACGAATAGCTTCCCATAACTGTGCCGCGAAACGTTCTTCGCGCGCTGATTTGGTC
TCAGCCCTCTTCGGGCGAGCCTCCAGAACTTCTTCACGAGCTGCTCCGGCGGCTGAAACGATGCACACTTGCTCGATGTCGCCGGTCTTAGGGTCGTGAA
GAATCTTTCCATGGTAGGGCTGAAAGAGATGGGATCCCTGAAACAGTGCACGGAGGGATCGCTACCTCA