Description :
From Genome Similarity Track
Location :
Scaffold_19:38875- 44057
Sequence
5182 bases(100 bases per row)
TCACCAGAAGAAGTCACGTACTGATGATAAGGCCTAAGGCGACCGACGTAGAACGTAAGATGCGTGCACATCTTACGTGGCAGTTCAATCGTGTGTGCGT
TGCCTAAGCGGCGCAGTACACGAGATTGACCGATGAACTTGGGTAGTAACTTGTTACTACCCACGTTAGTATCTATGTGTCGAGGTAAGTTTACCGTTGA
TAGGAGGACTAGTTCACCTTCATTGAATGAAGAACATTTTCCCTTCCATTCTTGTCTGCGTTTTGCTTTTGTCGGTCCACTGCTTCTGCAAGGGAATCTT
GCACGAAACGGAAAACCGTTTCGCGAGCCGGTATGAATTCATCTGCTGGCTCGCTGTCTTTGGCTATAGTGCGCTTGGAGCGCACTGTGGCAAGATCAGT
GACCTGGGTAGTAAGAGTATCCTCGCTTTTACTTTCCTGTTTTTCACCGAAGTCGATGTGATCGACATCGGAGTCGTACGTAGTGACCTCGTGGTCAGTA
CGTGATGAGTGAGAGCCGATTTGGCGTTCGCTCGAACGATTCCCTCCCCCACTCAAACTAGAGTTACACTCTAAGAAGTTGGGTAGGCGTGGGTGGCGCA
AGCCATTCACGAAGAACGACGTATGCGTAGTCGATGCATGCACCGAGTTGTTAATGGCAAATTCCACCATAGGCAAGAATTCGCTTCAATTCGTAAACGA
ATGGACATAACCCCGAAGGATTTCTTCAAGAACGCGGTTGGCACATTCTGTCTGACCATCTGTTTCAGTGTGGTCAGAGGTCGACATCTGAAGGCGCGTT
ACGAGTGTTTTGAACACGGATCGTCAGAATTCCGCAGTGAATCGTGGGTCTCAATCAGAGACGAGTTCACGGGGCAACCCATGAAGACAAAAGATCGTGT
CAATAAAGACACGAGCACATGCCGATGCATTGATAGATTCAGGTGCCGATGCATTGATAGATACAGCGACCAGGTGTACCATTTTACTGAATCTATCAAC
GAACACAAGAATACCGGTATTCTTGTGTGGGTCTGCGGAGAATCCAAAGACAAAGTCCATTGAGACTGATTCCCAGCATTCTGCCGGAATGGGCAAGGGT
TGCAACGGCGCACGAAGTGAAGGACCTGACTTCACTCGTTGGCATACTTCGCATGCGCAGACGTACTTTCGCACGAGCTGATACTGGCGGGGCCAGTAAA
AGTCGCGACTAACTGTGAGATATGTCTTCTCTCGACCACGATGTCCACCAGTAGGTGAATCGTGGTACACATACATGATGCGAAGTCGCAGATCACCATG
GTCCGGTACGACGACACGAGGCGTGTCAACGGCTGTATACTTCAGTAAGCCATTGTGGACTGTATGTCTATCCGTGGAGGATCTATATACTGGGGGAAAC
CTTCTAAGGGATTGACGGGATGGTTGCGAGAGATGATCCATCAAACGCACCATCGCCGGATCGTACGCCTTGCGTATGTCTTCGAAAAAGGTTGACGACG
GGACGCTCGACGTCAACACCGCGATAGTGGTCGGACTAGTGTCCGGTTGCGCAGCCGGTTCGAAATCGGGCCGGCGCGACAGAGCATCAGCGACGACATT
CAGTCTTCCTGGTTTATATTCTACGGAGAAATTATATTCCGCGAAGAACGACAGCCACCTCGCCATTCGCTGCGATAGTTGTGGACTGTTTACGGCCGTA
CGTAAAGACGCATGGTCCGTGTAAACGATGAAGGGTCTATCGCCTAGCAGGTAGACCCTGAGAAACTCTCTAGCTAATTGGTCTTGCACAGCGGCGAAAG
GTTTAAAAAGCGTCAGCATTATAATGCACTTGCGAGAGAGATGTAAAGACGGGCTATCTCATCGTGCATATGTTAAGTTCTTGGCTTTAAAGTGCGTCCG
GTTGCCGTCGGCTTCATACGAACGCGAATAGATTCTTGGAAAGCTTACCGAAGCTTGGTGTGCATTTTGCTACACCACTTCTTTCACCAAAGCATACTTC
ATGGCAAGGAGTTCCTTGTCATGGACTGGGTAATTACGTGCAGCCGGTTGCAGATGACGTGACTGATATCAGACGACACGCTCAGTACCGTCTGTGTCGT
ACTGCGTTAGTGCACATCCGATGGCAAAATCACTTGCATCGCAACCACATGAAATGGTCTGTCTTAGTTAGCAATCGCCAAAACTGGCGAGCGTATCAAG
CTTTTCTTGATACCTTCGAAGGAGCGCTGGCAATCAGCACTCCATGCCCACTTCTCGTTCTTTTTCAATAAACGAGAGAGATGAACAGTCATCTCGGCGT
AATTGTTCGAGTATTTGTGCAAATACGCCGGTAGGCCAAGGAACTTTCGAAGTACTTTTATGTCGGTAGGCACCGGCCAGTCAGTGATCGCTTTAATCTT
TTCCGGATCAGGCCGAATGCCGTGCTTACCCACGATACATCCAAGAAGTGGTATTTCGCTTGCAGCAAATATACACTTCTTGATGTTGGCATACAACTTA
TGCTCACGCATCGCTGTAAGAACCTTTCGGACGTGGAGTCGGTGGAGTTCCAAATCCCGGCTATGGACGAACACGTCCTCGAATAGCTAGGTGCAAATTC
TCGCACAGATCTCAACAGATTCGTAACGCATCTGCTGAACGAAGCAGGGGCATTACTCAGCTCTTGTGGAATTACTATCCACTCCCAAAGCATACCGCTT
GGGGTGCTCACTGCTGTGTAAGGAATGTCCTTTTCACGCATAAGGATCTGATAGAACCCGTCCATCAGATCCATCGATGAAAAGATGGTACTCCTTGACA
TACCATCTATAATGACATCCTTTCTTAGTATCGGCGTATGAGCCGGTACAGTGGAAGCATTCAACTTGTTGAAGGCATGTACTATCCACCATCCTCCTGT
GGTCTGTCGGATATAGAATGTAGGAGAGCTATGTGGGGAAGTAGATTCCCTCACATGGCCCGCTGCCAAGTGATCGGCAAAGAATTTGTCAATCGCTAGT
ACTTGTTCACGCGGCAATTGCCATTGCTTCATGACACAGTACTTTGACTCTGATTTCAGGTCTATCTTCGTGACGAGTACCCTTATCCTTGGGTAGCTCG
CACGGCACTGTTTCTGGGAACACATCTTTGAATTCCGTCAAAATCATCGTAGAGAGGATTTGTCTTGAGCGATTCCCACGATTGGGATGTGTATCGCTCA
ATCCGAGTCTTCTCATTAAAGACACTCTCGTCCATAGATGAGCTGCTGAGAGCCCTTTCGTTCTCAGCGAATACTATCTCCGACCTAACATCGGTTATGC
ACTCGTCTTCCGCGACGAGTACGCAAATCTGCTTGACTTTGCCACTACGCAGATCACGCACGAACCTCTTCTGTTCGAGCGTGGGAAACTGATTGATCTC
CGACGTTGTCTTCGGAGGCGCGATCAGATCAAGTTGGTAAGTGCCTATACGTGATCCGTCATTGACTAGGACATTGAATGTCTCTGTTGTCTCCTGGGAA
CTTATTTCCACAGTTGGGTGGGGACTTATTCCCTCACTAGCCTCTTTGGCTAAATCTTCATTTGACACGAGTGGAATTGCTCCCTCATTATCCTCTGGCG
GTGGTTGCGCTACAGCAGCCAGGTCTTTTACGTGCGATTCTCCAATCGCACTAAGATCATCGTATTACCAATCATTGGCGATCGGTTCATTTTCACTTGG
ATGTTGTCCGTTTGGAGGACACCCATGCCCCAGTCCACTCGAATTATTCGGGTGGTCGGCCTTCGGCGCGACCTGCATCTCAATGCAGTCGCCGGAATCT
GGCTTCATGGTGTGGCGATCAGCCACTCTATGGCAATGTGCAGTCGTACTATCGACCGAACCACACGCGAGGCCATCGCACTCGTAGTACACCCACATGT
TAGTGGGCGCTCCATGGCGTTCATCAGATGGTCATCTGGTGAACAAGTGACAGGCATATCGACTGTTCGTCGATGCCAGCTGACTTGTGGCTCGTACCTT
CTGAGCCACGGCAGCCCAAGGATGACATCAAATTTGTCATCCAAGTCTAATATGATGAAGTCGTCATTGTATTGGACTCCCTTTAGTGTATAGGTAATAC
CCACTTCAAGTTTCATCACTGTTACGGATGCGCCTGTCGCGAGGCGCACCGTTATCCTCGTTGGAGGGATCTCTCGCTCAACATATTCGAGCTCTCTTTT
GTCTAGCGATTGGCGTCGTAAAAAGTTGTTCGACGCCCCACAATCGACAAGGGCTCGAAGCGACATGCCTTGTGTCACTTCGAGCTTCTGGTAATAAGGA
AACCTCATTACCAGAAGCAGCAACACACAATGACTGAGTGTTGGGAGCAACTTTCGTCAAGAGGCCTGCAAACTCACTTGACGTTGCTGGATCAGTAGGG
TGCTCCGCACCTACTGACCCTGACCGTTTTTTGGCTGTCCGTTACGTTGTTGCGTTTTCGCAACAACGTCGGACCCACCCCTTGGACCTCGCTTGACCGC
TTGGCGGTTATTGTTTCCTGCGGTACGTGGTACCGCGCTCGGGGCACTGCATTCGTATGCAAAATGCCCTGTCTTCTGACATCTATTGCATTTTTGCAAC
TTCTTGTAGTTGTTAACACGAGAGCTCTCGCTCCCGCGTGACAGAAGTCCATTGGTTCTGGGCCTCCATTTTCCTGTCGTCTCGACGGACGATAGGAATT
CGAATTCGCGTGAGCCTGTTTCTCGCTGAAATCCTCTTGTTCAGCAACCCTTATTGCCTCTTCTAGGGTGTTGAACTCCAATCGGAACAGGTAGGTTTTA
ACAGGACCATCAATCAGACCCTGCATGAACAACGTTATCAACGTTTGTTGGTTCAGTGGGTCGACTGTTATGCAACTGGTAAGGTGACGTATGTACTGAA
TATACGAGTGTACGTCACATTTACCTTGCTTGATTCTCAGGAGTTCAGAGCGAGCCCTGAACTCAGCTCGCGGAGGCTCAAAAGTTTGCCTTACCAGGGA
CTTGAAGACTCCAACGACCCAAAGACATATGGGTCGTGTAACTTAAGGCTAAAGGCCCACGTTTTTGCATGCCCTGCCAAGTTCGATTGAGCAAGTGCGA
TCTGCATTTCCTCGTCGACGACATGACGAGCCCTTATCGCATCGTCTAGTTCCACGAACCATCTCAACAGAGAGCGGCTCCC