Description :
From Genome Similarity Track
Location :
contig_42:38866- 39898
Transcript NameFunction/comments
g9457.t1hypothetical protein

Sequence
1032 bases(100 bases per row)
GTTACGCGACTCCCGCATCTTCGTCACGCACAGTACGCAGAACTTCGTCTTGACGATCGCAAAAGTCCGGTTTGCCCCCAACGCGCTACCCGTCTCGTCC
TCCTTGGGTGCGTCACGTACAATAGCGCATCGTCGGCAAATGAGGTCTCCGCACAGTCTGCAGTGGTGGCGACGTCGAGTCGGCCCGAACTTGCGCGAGC
ACACGCTGCAGCTCTTGCGAGAGCCCGACTTGGCCCAGCTGTCCCGTTTCACGACGCCCTGCATCAAAATCCGTCGCGAGTCCACGAAGACCGCCATGTT
CATAAGAATGTTCATCATGCGCTTGTAGTAGTTGGCGGTCACCGCGAGTCCGTTGAAGTTGTTTTGCGACAGCATGAAGAATTCGGTCACGTTCGGCTCG
CGGTCGGCAGGTCGAGAGATCCAGATCGTGTTGAGCCGAATGCGCTTGGTTTTGAGCTTTTTAGGCAGGTCGGGGCACTCCGGGATATCAAGCGGCAGCG
TGACGCGTACACCCACGTCGCGTCCGCGTAGGTCCTTCGTGTAGATGAGGTACTCCATGTAGCAGTTGTCGCGCTTCTTCACGAGCGGCGACGGGCTCAA
ACAGGTCCATTTGATGCCCATATACAAACACTTTTTCTTGGACGCCACCGTGTGGATGTTCTTGAGCACGGCCGCGTCTGTAGCGTAGCCAAACATGAAC
TGGTTCCACGCGAAGAGCTCCGCCGACGTCTCGGCATAGAAGAAGTCGATGAAGTGGCGGTAGTCGCCGTTGATGCGGCCGAAGATGCGCGCCTGGCTCG
CCGTGGGGCTGTCGGGCGTCTCCTTCTTGATGGTAGTGAGACCTTCCACTTTACTGACGGCAGTCCACGGCGCGCGGTAGACCGGGTTCAAGCCTTTGGC
CTCGTGCAGCTCGTACTCGGCCAGCGCGTTCTTAACGATCTCCTGCATCTGCTTCTCGTAGTTCTTGGTCTCCTTGGACGTCAAGTGGATCTCCGGGAAA
TAGTCGTCCGGCAAAGGGAACTGGCCGCCGTT