Description :
From Genome Similarity Track
Location :
contig_42:38866- 39898
Transcript NameFunction/comments
g9021.t1RAW34113.1 hypothetical protein PC110_g9544 [Phytophthora cactorum

Sequence
1032 bases(100 bases per row)
GTTACGCGACTCCCGCATCTTCGTCACGCACAGTACGCAGAACTTCGTCTTGACGATCGCAAAAGTCCGGTTTGCCCCCAACGCGCTACCCGTCTCGTCC
TCCTTGGGTGCGTCACGTACAATAGCGCATCGTCGGCAAATGAGGTCTCCGCACAGTCTGCAGTGGTGGCGACGTCGAGTCGGCCCGAACTTGCGCGAGC
ACACGCTGCAGCTCTTGCGAGAGCCCGACTTGGCCCAGCTGTCCCGTTTCACGACGCCCTGCATCAAAATCCGTCGCGAGTCCACGAAGACCGCCATGTT
CATAAGAATGTTCATCATGCGCTTGTAGTAGTTGGCGGTCACCGCGAGTCCGTTGAAGTTGTTTTGCGACAGCATGAAGAATTCGGTCACGTTCGGCTCG
CGGTCGGCAGGTCGAGAGATCCAGATCGTGTTGAGCCGAATGCGCTTGGTTTTGAGCTTTTTAGGCAGGTCGGGGCACTCCGGGATATCAAGCGGCAGCG
TGACGCGTACACCCACGTCGCGTCCGCGTAGGTCCTTCGTGTAGATGAGGTACTCCATGTAGCAGTTGTCGCGCTTCTTCACGAGCGGTGACGGGCTCAA
ACAGGTCCATTTGATGCCCATATACAAACACTTTTTCTTGGACGCCACCGTGTGGATGTTCTTGAGCACGGCCGCGTCTGTAGCGTAGCCAAACATGAAC
TGGTTCCACGCGAAGAGCTCCGCCGACGTCTCGGCATAGAAGAAGTCGATGAAGTGGCGGTAGTCGCCGTTGATGCGGCCGAAGATGCGCGCCTGGCTCG
CCGTGGGGCTGTCGGGCGTCTCCTTCTTGATGGTAGTGAGACCTTCCACTTTACTGACGGCAGTCCACGGCGCGCGGTAGACCGGGTTCAAGCCTTTGGC
CTCGTGCAGCTCGTACTCGGCCAGCGCGTTCTTGACGATCTCCTGCATCTGCTTCTCGTAGTTCTTGGTCTCCTTGGACGTCAAGTGGATCTCCGGGAAA
TAGTCGTCCGGCAAAGGGAACTGGCCGCCGTT