Description :
From Genome Similarity Track
Location :
Scaffold_1144:3886- 5205
Sequence
1319 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCGCC
AGCCTCCGCGTACATTTGCTGTGAGTGCACTGCGCGCTTACGCAGACTCGTCATGAGGACGCCCAGCGACGCCACCATGAAGGGCATGACGCACGCCATG
ACGAGACTCATATCCCACCCGCGCACGAAGCCGATCACGTAGCCGGTGACGAATTGGCACGTGTACTTGACCGAGTCACCGAGCTTCTGGCCCATGCCGT
CCTTGATCTTGACCGTGTCGCCCGTGAGGCGGCTCGAGAGCGTCAGCGGGTCGCTGCTGTCGTACCAGCCGATGTTCATGTGCAGCATGTGCTTGAACGC
GGCGTCGCGCAGCGCCTTCATCTGCCGCTCGGACGAGTTGACGAACACCACGTACGCCACGTAGTCGGTGATGAAGAGCGCCACGGCGATGTAGATGTAG
TCGAGGGAGGCCTGGTTCACGGCGTCCATGTCCACGCCCCCGTCCGCCTGGGCGAAGGCCCCGATAGCGTCACCGAACACCAGCGCCATGCACGGGAACA
GTGCGCCGTTCACACCGGCCATCAGCACACCTAAGGACAGCAGCAGGTTGTCTCCGGCCGTACCATAGCGATAGAGCTGCCGGAAGGGGATCGTGGGCAG
GGGCTTCTTCTTGCTGTCTGTCGCTGTGTCATCAGGCTCGGAGGCGACGCTCTTGTTGGCGTCGGACTTTCGTGAGACTTTGGACACCTCGGCATGAGCG
ACAGTATCGACAGGCGCGTTGGCACGCGGGGTCATCACCTGTACGTAGTCGTGCTGTGACACAGGATCGGTTCCATCTCCGACAGCCTCGGGGTGGAGCT
GCGGAGGCGCCATGGTCGACTGGTTTTGATTGAGAGACGAGCTCTCGGAGACGGAGCCGATTGAAGTATGAGACGAGATCGTGCCTGCCTGTGCAGTGCG
GTGTCATCCGCCCGGTAAGATGGTGATGCCCTCTACTATATAAAGGAAACCTTCTGCGAGCTGGAACTGATCAGTTGGTTTCACACTTCATGCTAGTTTA
CGCCCGATCCGTCCAGAGTAACGAGGTGTCGTACGGAGTTGGCGGCAAAACGCTTGATGCTTCAGAGTTCTGACGGCTAGACATGCACATGCATTCAGCA
CCAGCACCAGAACCAATGCATTGTGAGCCGTTCACAACTCTCCTCCAACCACTAAATCTACTTGAGTTGCGGTCGTTACTTGGCGTTTTCGCTGTCCGAC
CGCGCGTAATCGACAATCG