Description :
From Genome Similarity Track
Location :
Scaffold_40:388560- 396670
Sequence
8110 bases(100 bases per row)
CAGTCTTACATCTACTCTATCAAGTATCAAATCGCTCCCACTGAGGCAGGGATCACATGGACCAGCGCTCACTAGGGTAGAAAATTCTCTTAAGCACTTC
CTCTGTGCAAGGTGCTGTGTGACCCCGTCACATTGGCCATGTATACCTTCTCCTCGATGATGCTTACGAACCTAAGTACGAATCGCGATTTAAGCAACCT
CGCCGGATGCTATGGGCAACAGGGACTTCTTGAATCGCCCGTAGGCTTCTTGCAATTTAGCAGTCCTTGGATTTTTTTTAACGATACAAGTTCGCGCTCA
GCGCATTGGTTCTCTCGCTGTAGCGCTGCTTGACAGACTCCAACTCATTTGGGCCAGTAGGAATAACTCTGCCTTTGGAGCTCAGCAAGAAGTCCAGGTC
TTTAGGGCTGTAGTTCTCGACTCCAGCTATCATCCTGCGTCTTGCCATGGTTTGTTCTGCTGATGCGAGATGCTCACTGCTGTGCTCTCAATGCGGAATT
GAAGAGTGTTTGTCGCTAGCCCAAATCAGTATCGACAGGTTGTTTGGCTTTGATTGCATCGTTCTATTGGATTTCAAAGGTTTGTTTCACCAAAACACAG
ATCCAAGATCTGATAGGGGCCTCTTGTATATACTTTAATATACAACTAGAAGTCATTTACATCTATAGGGACATTTCTCGCCGTTTTACAAAGTCACGGT
ACTCCTTTTAAACTATTTCTTTTATAAAAATCATTTAAGATAGGTGATGCAATCCTTCATGAATTTGCCTGGATTAAAATATTCTTAAATGATTACGAAT
CGCACTGTAAATTAGACAGTACTGCACTCCGTTTTCGCGCCCTTGGACCTTTGATAAACTTCTGGATGTGAAGATCCTAAATCCAAATGAACTAAAGCTT
GTATGCTGAAACATGATTTTACTTGCACATCCTATATGGTCCTCCCCTGCGAAAACGGGGTGCAGTACTTATTGTCGCAACATATAGTTAAACTTCCGTT
TAAGGGCGAATAATGCGCCTTTTAAGAGGCTGATTCCTACTGTTCTTTGCACAAACCACTAAAAGGGCGACTTCTGCGCCCTTTTGCCACGAAAAGGGTG
TGATAAGTAGATCAAAGAACAAAGTACTTCAGGTATGAAAGGGAAGTAAAAATTCAAAGTTTTTTTCTGCCAATCCTGGTTGAGACAACTTGAGCTATGT
ACAGAAGTCCCATCAACAAGCGAATCCGGGGTCGCCTGATTAATTTGCATAGGGAATTCTTAGCGCTCTTGTGATTTGTCAAATGTTCCCCAAATCCATG
TGATCCGATACAGTATAAAGGAGTATATGAAGAACATGTACAAGCTATTACCCTCTCTCGTCACCGCTAGTAGCGATCGCTTACTTGATCTATACATGTA
TCACTGTAGACCGTGCTTTGCTCCGCTGTGCTGCATTCCTCGTTGGGAAGTGTGTTAGCTCGCACCACCTGGTACTTCACCTTGAACGAGCGTTGCAGTA
TTAATAATACGCTTGTTCAGGGTGACTTATGTACTGGTATTACATTTAGGTTTAGGCAAACGTGAGATAAAGTAATCAATGATTAATGCTCCCCGTTAAC
TTCTTACAGTACTGCACCAGTAATTTACATGTACATGTACATGTATCGGTACACACTGTACTATTATAAGTCGTTGCATAATAAGGATTCAACTGTGTGA
TAGGAAGTCTCGCACCCAATGTTGACAACTCGCTTCTTCATTCTTCAAATAACCATCCGAGCGCACGGACACCGAGGACGGTTGGTCGCAAATGCGAAGT
CCCTGGACTGTTGTGGTGATCGTAGCTTTCCTTTCTCTTATTGGCCCTGTTTCAGCGGTGGGTTATGGATTAACAACACCTCTCCTGACAGCCAAGAATC
GCCTGATCAAAAATTCAGACGCTGCAAATATGGGCGACAAAGTGAAAGCTAACTTTCCAGGGTTGTCGAACGTCGCGAAACTGGCGGCGGACTTTAGTCC
ACTTACTCAGAAGGTGGCATTTCGGTTGTGGCTGCAGCAAAGAGCAAGCCCCACTCACGTTTTCGATGTACTACACAAGAACATTCTCAAAAACATGGGG
ACGAATCTGGAAAAGAACACTGCTCTGCTGGACTGGTTGAGGTACACAGTGGCGTACAGGGAGAAGCCGGGGAATAGCAAGTTGTACCGGGATGAAGAAA
TTTACTTGCGCTTGCTGAAGTTGGGCCCCGAAAGTACACTCGCCTTTTTCTTCCAGTCTCTACGAAGGATTCCGGATCTGAAGCAAGTGGGCGAAAATTT
GCAGATAGCACAGTACAAACTGTGGTTGAGACTTGGAATGGGGCCAGACGACGTTGCCAACAGTTTGGGTATCACGCACATGTTGGAGTCAGGCAAGGTG
ATGAGCGATCCAAGATTTATCATTTATTTTGGCTTTGTCGAGGTGTGGCTACGCAAAATTTAAAAAGAAGTCTTAAATGACACAAGCTTACCGATTCGCT
AGCTTCTAAAAGGCAACTAACGAGAATTTTCGAATGATACCCAGTTGCTATGGCGGGATAAAATTCACCACCAAACTCCGGCTTCTCATAAAAAAATCTT
GTATAAGGTCATGTCGGTCGAACGCTGAAGTGATGTTCGAAAGGTGTTAGCTTTAAAAGACGAGATTTTTGTCTGGTGGAGACAAATAACTGTCTGTAAC
CTCCCTACCTAAGTGTAACCTTTCTCATTCAATAAGGGTAATATTAATTAGTGCCCCGGGTATTAATCGGAAATTTTCGTTATTGTAGTGCAGGGATAAT
GCCAGCCGCCTCCAACTAGCAGCAGCAGCAACAGTGAGCAGGGATAACTGCTCGTAATGACCAGCCTGCTTACAGCAATGATGATGATAGCAATGCATAA
CGCAGTGCAGGCTTACCCATTGACACTACTGTTATTGATCGTTGTTAATGAACATCGGCATTACAAAACCATCTTATTTTTGGAATGTGAATTTTAAAAA
TGTGGTCAGAATTAGCTGATTCGCAGTCGTTTCTGCGCTATAAGACTATTTTAAAACTCTTTCCAGATGCCCCAAATTTACGGGAGCAAGAAAGTACAAG
AAAGTACGCAGCTGAACAGCAGCTAATCCGATTACGATTGTAGCTACATATTTGAGTGCAAGGAAAAACCAAATATTTATTTAAACAGGCACCTTATCTT
CCGCTTTGCTCGCGCTGGGACAGATGACCACTTTTTATTGCTATCTAGAATTATCGCTTTCCACAGGTGTACCGAGTTTAGGGTACCTGTTGGGATATTT
GCTCACAGAAAACGGCTAATTTTTCAAGTCGCCCGTGACGTGAAACGATCTGGCAAAAGTGGATGGCAAAGCTATTCATCCACGTGGATTCGATGGCAAG
TGCCGTGTGTGGGCTGCGAGCGATATAAATGCTTTTTGGGACAAATTTAAAAAAACTAATGTCATTTGCTGGCATACTCTGAACGAAAAAGCCAATGTCC
ATAGCTAACAATCTCTAAACAGCGATAATTATGGATTCTGTATCACTATTTGGTAAATTGAGGATAGAGGTCACTCGGTTTTTGGCACTTTTCGTTTAAA
TATTTGTTATGCAAAGTTGGGCACAGATTATGAAACAAGTACTTTGGAGAGGAAACCAACAGCAACAAAAAGTTCATTGAAATTGAAAAATTGGGTGAGA
AGGCAATGTTTGGTGGTGCATTTCATCCCGCCAGTACAATACCGATTCCGCGTTACAAACTATGCGACTCGTTACGCTCTTGGGCTAATATATATACAGT
ACTGCACCCCGTTTTCGTGCCCTTGGACCTTCGATAAACTTCCGGATGTGATGATCCTGGATGCAAATGAACTATTACTTGTAAGCTAAATTCTTGTTTA
TTCGCAAATCCTATATGTCCACCCCCGCAAAAACGGGGTGCAGTACTGTATATGGAATGGAATACTTGGCTCGTTTGGAAGCTCGGCACTGGGTCCACCT
CCGCAAATACGACGCGATTAGACAGCTTTCGCATCTGCTCGACATGCACGTAAGTGAACTCTATGTCACCCCCTCCATCTCAGTTGGGAGCAAAATCACT
ATCATACCGTTTTGCAGAACAGTCCAATAATATATTTAACTGCAAATTTAAAAGTGTATAAATTGCTATACTTTTTCCCGACCCAAGTCGACGTGTGTAG
GAATTTCTTCTACTTTAAATCTCATATCTAACAGATCACTTGTGGTGTGTTCTCCGTAGCTGAGTGTGTGAAGCTAACTACCTTGATTTTTGTTGAGGAA
AAATGGGTCAATAATACCACCAATCATTTTTTTGTACGGAAAATCTACTGCCCAGGTTGTTTTTACATGGCAGTGCGACAAATGACCAGGGTACAAATCA
GTACGGTATTGACCAGAATGTAATTATAAAGTAAATTACAATGATGTGCAAAGATTCCCCTTACCCTATCAAATCTTAAGATTTTGTACAACGGTGGGCG
GTGCAACGTTCTCCTGGCCTCTCATTTCTCAATTTGCGCCGAAAGCCCACAATGAAGCGGAAACTGTGTAATGTTGAAGACGTCGACTCCGACGAAGACG
ACGAAGCTGTGTCAACGTTCGGTGGAGGAGAAGATAGTTCAGGCGACGACAATGAAGACACGGACCGGACGCAGCTAGCCCAGGGCACGCAGTTAGTTCG
GGAGGGCAGCGAAGACTCACTCGACGATCTCTTACTCCAGGAAGATTCATTTGAAGGGAAGGAGCTGAAGCGGCTCCACGCCAGTTGGGACGCTTGGGAG
AGGTATCGCGTTAATTACTGCGAGGAGGAGAGCGCGAATCTAGTCGTTCAAGAAGCAGAGAGTGTGTCGAAGCGCAACAAGCAGCTGCGTGAGTCCAAAC
GTGCGAAGAGTGGCCGGGGCGTCCGCTACTTACCTGACGACTTACCGCGGTGGCGACGCATGTATATTTGCACCCATGGAGCGAAATCTCGGCGCCGTGG
TATGGGAAAGCGGCAACAGTACCGACTTCGTGGTACTGGCTGTCCGTTTCGATTCACAGTCGAGAGTATTTTTGTCAAGGGCAAGTGGATTGTAGAGGTG
AAGAACCCTATATATACGCACAACCACGCGCTACCCGAAGTGGTGCTCGAAAACTATCCACATAATCGGCAGATACCGATGTGTGAGCCTATTTTTAAAG
ACCTCCGGCTGATGATTCGAGCGGGCGGTAAAACTTTGCGCATTTACGAGTAGATTCGTGACTATTCAATCTACAAGGTGACGCGCAAGGACGTGGCTAA
CCTCCTAGTCAAGATTCGCAATGAAATGCGTGGAGAAGCAGACGACGATTTGGCTGTTGCAAAGTTTCTTATGGCGTTTTGTGAAAAGGACAAAGACAAT
GTGGTTAGTGTGGACGATACATCTTCCGGAGAGACCTGTGCTATTTCGCTGACTACGAGACGTATGCGAGCCACGTTCGCCATGTTTCCAGAGCTCTTGT
TGGTTGACTGTACCCGCAAAACCAACAGGTAAGGTTTTCATAGGGAATTTTCCAGGTTTCATTTCAGGTTCATGCCGGGTTAGACACCAGGCTTTCACAT
AGGTGATTTGCCAGGTTGAGAATCAGTTATAAACCAGGTTTTAATCCTTACTAATTCAGTTCACGTTTGTATCTTCAGATATGACTACCAACTTTGCAGT
TTAATGGTTATGGATGCGTTCGGTCGAGGGTAATTCGTGCAGTATTCGTTAATTGAAACGAATTCCGACTGGCACATGCGCAAAGCTCTTATTCACTTCA
AGACTGCCAATGTTGGTTGGGACGCACTCCGTGTCATGATGGTCGATAAAGACATGACGGAGATCTCTGTGATCCGTGAAGCTTTTCCTGAAGCGGCTGT
TTTGCTCTGCCATTTCCATGTGTTGAAGTTTTTACGTGGGGTTGTCCGTGAGGCGCGCTTCGGGCGTTATTCGCCAAGTCAATACGATGCCATGGGTCAT
CTTTTCGCTAACTTGGTGGACGCTACTTCAGAAGAGGTCTACGCTAAGAATTTCTCTCTTTTAGAGACGTTTTCCTGCGCTCAAGGCAACGTGTCGTTTT
GGGAGTATCTTTTGGCGAAACTGGGATGAAAGCAAGGATATGTGGACACACTACAAACGTCAAACATTGCCGCATTTTCGCAACAATACGAACAACCGTA
TCGAGTTGAACTTTTGAAAGATCAAACTCGATTTTGACGGTAGTTGCACAATGAAGGAGTGTCTGGAGTCTCTTCTTCGAGCTCAGCGTCGATGCGATAA
CGAAAGTCTCGCGAGGGTGGCGTTTGAGGGGGCGTGGACCCATTACGGTTACTGTAACGGGCCTGGGGTGTCCGTTACTTGCTTACACGTAGTGATGAGG
AAGCGTACAAGTCCAGTGATACTGAAACCAAGTACTTAGTCTGAAGGAAAATCAACTCTGTTTTTATTTATGTCCAGGGCGGCTTGCCCTGACCACTCAA
ATACACGTCAACTCCTTATTGGTTGATTATGGGTCTGGCTCCCCATATTTCAACCAATAAAGTGACGGCAGTTCAGCACACGCTACTCGTGTGCTGCTGC
ACCTACTTTTGTAATGCAAATTTACCTACTTATGTAATGGTGTGAACCACTACAAAGAACCTATAAAACTACCTACATATGTAACTTGGGAGGGCCCATT
ACATCACCCCCCCCCTCTTAAGACAGCAATCACCTAATGTGGGTGCACTTCGGAGAACAATCGGGAAAAACTGGGAAATGGCAGAGAAGAGAACGCTTGA
GAACTTGACGGGCGGGAGCCTTTGCGAAGCCCAGGAGCAGCACAATACAACTTGCGCGGACGAGAGCAACATGGCGCAGCAGACGGGGGCGGCGAAGCAG
GCAGGAAGCGGAACAACGCGGACGGCTCCAGCGTCGGCGACGACGCTGAACAGTGGGTGGACCGCTGATATCGCACCTGAGAGCGTGAGTCGACTTGGGG
TTCGGCCCGGCGTGATGAACGAGGATATGAAGCCGTGGGCGCTGTACGACTTGTCCGGGGCGGTGACCCCGGACGCGCTGGACACCATGCAGGACCTCTT
TCGGCGCTTCAGGCGTCTCCGGAACAAAACACTCGACGGCGCGTCGTATGAAGCTTTGCAGATATCATGGTGCGCATTCATCCGGCGGTGGAATCGGATG
CAAGAGGCTGGAGAAAGTGTCGTCGGCTGGCTCGGTGATCGCGAAGCCCTACAAGCCGAGCATTCACTCGGTGATCTGCACCTGAAAGTCTGCGACGACG
CTTTGACCGAAGACCGTTTGTGCTATGTCAACGTACGCGAAGGTTGCAGCTCGTGTGACATCGGGCGACGCCCGACGCAAGCTGAGTGGGATCAGCATAT
TGTCGAGTATCCGCTCATGCCAACCGAACACACTTGAATCGAGAAGTATAAGCATCCACTCTCCGAGTTCACCCAGGCGGCTATTCGCGGCGGCTCGCGC
CGACAGCGCTCGCGACGGAGCCCGTCTCCGGCGCATTCGACGTCTCGTCGGGCGCGTAGTCGATCGCGTTCTCGATCGCCGCGAGGTCGCTCGCGGCCGC
GTTTGACTCAAGGCTGGAGTCGTAGTCGTGGACGACATCAGGAACGTCACGAAACAAGTTGGCGTGAGGCTCCCACGTATCATCAGCAGGTTGAAACCCG
AGCCATCGTATCTTATACTTCCGCGCGGCGGGATCCGCGTGCTGAGCCGACGACTTGATCGAGTGACGCGCGCGGGGAGGATCTTCGTGATCAAAAATAC
GGTCCACGATCCAGCACGTATCTCCATTCGAGTCAACGATGGCGGAGGACCGTCGCGGTGGAATTCGACGCGACCTGGTTGACCAGGACGACGTTGAGCA
GGCGCTGAACATTTCTCGAGACGCACAGGAGGAGGCCGAGCGGGCGGCTGAGAGCTCTCGGAACGCCGAGGCGACGGCGAGTAGTCTGCGGCAGTCGAAT
CGTGAACTCTTGCAGCGACTGCGTAGTCTGGATGCGCAGGTGTTTGGCGGACCGAGGGGTGGAGCTCTTCCACGCGAGCGGGGAACTGGGACAGATGGGA
CGCTGGCTTG