Description :
From Genome Similarity Track
Location :
Scaffold_12:388482- 391037
Transcript NameFunction/comments
Phyin_T30-4PITG_07809Casein kinase I%2C putative

Sequence
2555 bases(100 bases per row)
ATTAAAATGGGAAAAAGTACTGTATTGTGTGAATAGACCACTGATGTGAATGAACTTCCTCTTGCGTGTGCTGGCTGTAGCAGATACACTCTCAACGAGC
TGAGCGCAGGTTGTATCGCTTAACAGCAGCCGTGGCAGCAGCGTGGCCGGCGATGGCCTTGAATACTTCCCGGTCTTGAGGCCGCACGTCACTCGTGCAC
TCAACTTCAACACCATCTTTGTCAGCAGCTTGTTGGTCCTTCTTGCTCGCGTTGCTACCCTTCGGGGAAGGTGCTGCTGCTTTCTTAGTTGGTGCCTTGC
TGTGACGAGGAGTAGCTTTCTTCTTCTCAGGGGCATTTATTTTCTCTGTCTTGGCTGCGGTGGGTGGAGGCACTGTGGGAACTTCATCCGCGCTTTTCAC
ACGCTTACGCACGGGGCTGTCGGTGGCTGACTCTTGCGTTGCAGCAGCAACCTTAGCAGCCTTCAAATTTCAAGTACACGATATACGTCAGTTAATCTAG
ATGGGGGTGCCTTCAGTGCAGCTGTAGACGCACCGCTTTGCTGGTCTTCCGCGTACCCCACTCAAACGGTGTACTCAAGCCTTTACTCCCACCTAATTTC
GAGAGCTGCATCACGAAGAAATCGTAGTCTGGTCGATCCTCAAAGCCGCAGTAACGAATGTTCTTAAGCATTGCGCCCCATGCATTAGGAAGCGAAGCAC
AAAGCTGTTCCACCGAGGTGGATTTCTTGATCTTGGCCCCTTCGGCATCACTTGACGCTTTCTGCCACGGAAGATTGCCCCGCATTAAGTAGACGAGTAC
GTACAACAATGATTCAATGTCGTCTCGGCGGCTAGAAGCTGACGATAAAACAAAAGTAAGAGATTCCCGTTTCTCCAGCTAAGAATCCAAAAGCGAGCGA
ACGTACTGGCACCGTCGTGGCAATTAATGCTCAAGAAGGTCGGCGTTCCCACAACCGTTCCTTCCTTGTACTCCTTGTGCTTACCCGTGGCGGTGACATA
GCGATCGGAAATACCAAAGTCAACGCAGTACACAGTGTTCTCCGAACGCATGTCCAGCATGAAATTTTCAGGCTTCACATCCACATAGAGGATGTTCTTC
ACGTGCATCTGCTGCAGCGTCTCCAACTGGTCATGTGCATTAAAATGGGCATAATGAGCTGCAACCAATTTAAGGCCACACGTACGATTTCTTGGCCCAG
TCGAGCTGCTGTGGCCGACGAGACAGGTCCTTGCTCCTGCAGCACCGTCTCTAACGTTCGTCCAAGTCGCTCTATCACTAGGAAGCGATATCCCTGTAGC
CGAAATGACCAGTTAATAGCCGTAATCCACAGCTAATGCAGCAACATTTCCACCGCACTTTATCCTCCCCGTAGGCTCCCATTGGCACGTAAGGGATACC
GGGCTGGTCTCTCAAGTGGTTCTTGTACAGCAGGTGCTCGGCGTACAGCGCATCAGCGTTGCGCTCCGCTGGCGTCTTCTTCCTTTTCTTGTTCTTAAGC
TTGGCCGCCGGCAGTTGTGGCAGTGGTGAGAGCTTCATGACAAACTCACGGCCGGCATCCCTGCTGAGGGGGCTCATAGGTTCCACTGCAGCACATAAAG
GGATTAGTGCGTAATAATTCGATGAGGACTTGACGAGGGATTAACCTACCAGCGTAGACATCGCTGCATGCTCCTGAGCCGAGCTTCTTGCCCAGCCGCC
ACGACTTGAGCGTCGTTCCCTCCATCGACAGCTGCAGTGCGATAAAACTTATTATTGTTTATTCGTGGAAATGAAATAATCTCTGACAATCTCCTAGGTA
CATTGTATTGGTGGTATTGTATTCGTGGAAATGAATTTTGTCCTTTTCACTTAGCCTGATGCTCGATTTTTAATAAATAGAGGTCATTTTATTAAATCGA
CGTCTATAAAAAGTTCTCTTCCCATCTCATTTTTACGCGTGGTTTTATGCTCCGACCATGGCTATAAAACGGATGGACATTCCATCTGTAAACATGGATT
ATTATTAACTATAATAGCCGAGCGCCGCCGCTACGCGGCGGTAGTTTAGGTTTAGTTTTATTCATTTGCTTCGACCTTCCTTCCCCGCTGCGCTTCGGCG
GGATAATTATTGAAAAAACCCCTGTGTGCCTAAATCGTTTTTTTCTATCTCGGGCTAGCATCATATTTACTTATTGAATTAATTGTTCTAATGATCTTGA
ATCAATATTCTTGATGCAATCTTTTTATTATTGTTAGCTATCACTGCATCTTCATCTTCCACCTAAAACCACCTGCACTTCAAATAACATTTAAACAAAC
GCCTCACAATATTTTTAGTTTAGCGTCGTGCTCGATATCACGGACCATTTCCGAGCTCACATGATAGTAATGGTCTGTCCAGGTTGCACTACTTACCCGC
TTGTACTGCCTATTTGAGCTTGTATGTGACGGGGTCACAAAGCTCCTTGCACAGAGGCAGTGCTTAAGGGTATTAGCTACCCGAGTGAACGTTAGTCGAC
GTGTTCCCGGCCTCAAAGGGAACGGTTTACTACTTAGAGGAGTAGATGTAAGTGT