Description :
From Genome Similarity Track
Location :
Scaffold_102:38843- 40724
Transcript NameFunction/comments
Albla_Nc14068820conserved hypothetical protein

Sequence
1881 bases(100 bases per row)
AACAAACAGATGAAGCATTTAGTAGAAGCCGTTTTGCTCAAAACTCTTTTGCATGCAATCAAACGAGGCTCAATAGAAGGCATACGAGTCGCAATTGAAC
GTGGTGTTTCAATTGATTATGTCGATGGGAAAAGTAAAAATTTGATCATGTAAACGAGTAGGCGGTGTTGATGAAGAAATTGATTTGCGCCTTTGTAGGT
TTGCTACAAAGTTCGACACGGATGTCAGACTACAAGTTGTTATAATTCTGGCGGATGCTGGCTGCAATATCAATCATCTGGATGCGTTTGGTTGGAATTG
CTTGCATCACGCATGGTAATTTCTTTCGATTGTCTTTGAATTCGACAATAACCTTTGAACCTAATGCAGTGCATGTGGAGCATTGGATGTTGCACACGAG
CTGGTCAGGCGGTATGTGAATCATCCTGTGGATTTGGATTAGCGTGTCATCAAGGATTTGGATATAGTGGTGTTTGCATCCTTCACAACCCGTACGGATA
TGGACCCGAGGATTTCATCGTGCCCAAAGTATCTAAAGCAAGTAGTCTTCTTCAGCATACGGAACAATTAACACATGTGGAAAACGTTCGATCATCGTGG
AATTACTTTCGCAATGAATGTGAATCGCTGGGATACGCGCTGCATGCGGACAGTGTACGGTAGTGCTTTCGGACAATGAATTGTGATCTATAAACTCTTG
CATGACTTGCAGCATTGTACCTTTCGAATGCCACTGAAGGTATCGTTTCAAGCGCCGGAAACACACAGCTTGCAAGATCGAATCCGAATAATTGATCTTT
ATTCAAAAGTTCCGCCATGGAATCAAGTTTCGAAGACCATTACGATTCCACCAGGTCAGTACATCAGCTGAATGCTTTTCCTGACTGAATGGCGATCTGG
AATTGCAGGAGGCGTTGGAACTATCACCTTGGATCATGAGACTCTGACACAAGAGTCACAATATCGTATCCTTTATGAAAGATACGAAGATGAAATGAAT
AACGGAGAGGGTGCAAGTAATTCATCAGACCTTCTGATTACCAATTTGAATACTGGGAAGCGATGTTCTATGGAGGGGATCAATGAATTAGTTGTAGCAA
ATTTGGACAAAATTCGTCCGTTCAGGTAGGAGTGCTCGAGCTTTCAATCCCGAGATGATCGTTCTCAAAGTTTTGGCCGTGTAGCGCGCAGCATTTAAGT
CATTCAAATCTGGTCGAGTAAGCTACAAATGATGTCTCTGTGTCGATCGTCGAACTCAAACTCTCATTCCATCATCAGTAATGACATGCGACGTGATCGG
GCTGCTTCCGCTATGTGCGTATGAAGAATTTGATCTATCCATTCTGTATGCATCAAATAATCCATTGCTACCAACTTATAGAGCAGAAGGCTTGAATCAT
GTTGACGAAGAATCTTTTAGGACGATCGCAATGGAACTGTGGGGCGCCCATTTCTCTCCGGTGTCGCGTCTTCCAGACATCAACAACATACAAACCTCGT
ATAAGATCATGTCAACGGTCACGGTCAACGTTTTCCATTCTACAGGCGGCAAATCTAACGAATATGAAGTTGCGATACAAGAAGCCGGAAAGATTGGACT
TCATCTGGTTTGTGTTCCTGCGGTTAAAAGATGACATGCTCTCATAACCATATCTGTAGGAGCCTGTGTCGGAAGGCTTCCGACGTGTTACGCGGCTCAT
TGTGCGCCACGGCTCCAATCAAGCCATTTCTGTCAGTCCGGGTGACTATCTGATTGGTATCAACAACGCAAATATCGAGCATGCTGGCGTAAAACATGCT
ATCTGGCAACTAAAGGAAGCGGGTCGACCTTTGACTTTGCGGTTTCGACGTGGAAATGCCGAAAAGAGACCAAGTTTGTTC