Description :
From Genome Similarity Track
Location :
Scaffold_1388:3883- 6184
Sequence
2301 bases(100 bases per row)
CGTCTGTATCATGCGTCGGCCGATCCATTTGCTTGGGGAACGATATGCCATAGTCGCCCCGCTGTCTCTGCCCCAGGATCTGGTTGAAGGCTCGAAAGAA
ATCAGACATAAGGCCCTGGTTCCCGATCATGCCGAATCATCTCACTAGCTCCAAATCTTCGCAAAACGCACTCCTCGTACGATTCGGCGATGGTTTGTGC
AGTTCTAGACGCGCTAGCTTTGGCTATCACGTATCCGGTAAACAGATCTACCCCAGATCAACAACTCTGTGTTTCCTTTGAACGACTTGGGCAGCGAGGG
GATGTGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGACATTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCC
ACACATTCCCCGACATAGCGTTGTACGCTCTTGAATAGTCCCCTTCAGTGGAAACATTCCCGGATCCGTTGATAGGTCCGACCAATACCCTGATGTCCGC
CTTCTAAACTAGCGTGATAGTGATGTAGGACGTCCTGTTGTAAGGTTTCCGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTCGACTCTCTTCGT
AGGGGGACAATAGAAGAGCAAGTCATTCAGATCCATTGCGTATTCCGTAGCGATAATACTGTAGAATTTGGTATCCTCCCGACTCAGGTGTCGTACATCC
CCCATCAGATACTTCTTTAGTCCCAAGATACACGCTTCTTCGTTCTGTGCTTTGTGAATCCGCTCAATGCGGACTCCCTTCACAAATGTTTCATCGAGAA
TCTGGGGGCTGGATCCAATCCTTCCTCTGGACCTAGTGAGAGCCATCACCTGGACCGTCCTTTTCCCGGATCCAACTACCACCACTTGGCTTAGTCGGTT
TAGTGTGACAAGATCTTGACGCTCAGCCTCTCTCTCCACCTCAACCCCACATTGATTCCGTAAAGCGGCACTGGCCAAGCTATCTGCACTGGCATTCCAA
TCTCGCTTGACATGCACCAACTCGTGATTCGTCCAGCCACGCAGGCGGACCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCGATCT
CACCTCGCACCTGTCTGATCACCAAGTTTGGATTCCCACAAACCACCTGCCTTTTTGGATCCTATCCATTTAGTAGATCCAAACCCAACAGGAGCCCGTT
GTACTCTGCTTCATTGACGGTGAGGCCTTCCGCATAAGTGGATCTGGCCCGTACAACTTCCCATCCGGGCAGTCTCCACAGTATTGCGCTGTATGCTCCT
CCTCCGCATCGTACGCGAGCGGATTCATCGAAACTCAGGACGTACAGATCTTCATCCACTTGTACCGTCGAGATCGGGATCTGGATCCGGCGTTTGGGCT
CTTTCTTAGGAGCGATCCTAGTCTGCGCCTCGTCCATCTTAGCTCGAGGTGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCAAACA
CTTCACAATCTCCAGTGTCCAAGGCGAGAGCAAAGCTGCCCACTGTCCTAAACGTCCTTGTAACCCGGCCGACTTGAACAGCCAAGCTAGCGTAGAGTGT
CGAGTCAGGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTGAGATCCAACACGCGCAGGAGCGCGAGAATCACCTTCTCCACCGCTCCGTAGTTCA
GTTCATTTGGCTTCAGTGTCCGGCTGATGAAGGTGACTGGGTGACAGATCCCATCATGTTCTTGTACCAAGGCTGCGGAGACTGCCCAGTCACTGGCATA
AACTATAATCGTAGGTTGACGTTCCGGATCGAAATGACAAAGGATGGGCGTGGTCGCGATCCTGTTCCTCAGCTCCACGAATGCGTGTTGAGCTCGGATC
CACCGAGATTCTGCCTTTTCCGAGTTCTGATCCGTCGTCTCTATCCTGATTGGATCCTCTTTCCTTTGGTCCCGGGGTGGATCCAGCTCCTGTTTTAGGT
CTTCTTCTGGCGTCGTACTACGTGGATCCCTTCGTGAATCCGACCTCTCCAGGGCCAGAGCTTGTTGGATTTTGATCCGGACAGCTGGAGTGGCCATCGC
AGCAAAATCTACCTCTCTCAATTCATATAGTACCGCAGCAAACAGTGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGC
ATCGCCCGTAACGACTGTGGGAAGGACAAATCCGCCAACGAAGACAGGTCCTTAGGATTCGCCTCCAACCCCTCTTTGGAGACTCGATGACCTAAGTAAT
C