Description :
From Genome Similarity Track
Location :
Scaffold_1911:3883- 5680
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1911-snap-gene-0.2Gene of unknown function
Pytar_ATCC12531maker-par_contig_1911-snap-gene-0.3Gene of unknown function
Pytar_ATCC12531maker-par_contig_1911-fgenesh-gene-0.0Chromodomain protein

Sequence
1797 bases(100 bases per row)
CGCGCCGGGGCACGAAGTGAAGAAGCATGTTCGCGGCAAGCTGCTGCGATGGTAGATGAAGCTGATGGAGTATTGGCACTCTATCGAGCACATCGACGGT
GTGAAGAACGTATGGGCAGATATGGTCTCACGCTGGGCGGGGAACCACGGCAACGCAGATGCGATCCGCAGAGTGGCACTGAAATGCATACGCGCTTAGG
CAGCCAAGGAAATCTCGTCCAAGCAGCCATGACCCGGAAATAGCGCGCACCCCAACCGTCATGCAGACCAGTCGGTCGCTAATAGTGACCATCATAAGAC
AAGCAGTAAATCTCCAACTCGGGTCCCGCTGAGACCATTGGCTGACGACAGTATCGTTTGGCCGACGGTTGACGAGATACGGAAAGCGCAGTCACTGCAT
ATGATTGACAAGCCACAAAGCCTGAAGATGAACACGTACGACCTGTGGTGCAAGGTAGGTCGCATTTGCGTTCCAGAACACGGCAAGGACCTAGTCCAAC
GGTTCCTCGTCGTTGCTCACTCACTGTGGATCACAGGGATACAGAGGGCAAGAAGTACTGTTCACCGTGATGACCGAACGATTCTTTGTAAGCGGTCTCT
TCGCCACGATCAAGTCTTTCCTCGCTGTCTGTCTGAAGTGCCAGCACGTAAAAGTGGGAAGGTGGTGCATAGACCGTGGGCAGCGACATTCTGGTGCAGC
GAGTGGAACTGTGCGCTGCATTGGGGAGACGTTAAGCTCGGTGCCGCGTTTGGTGGATACAAGAATCTGCTGGTGCTCAAGGATGACGCAACGCACTACT
GTGAACTAGTGCCATGTGCAGAACCCACTGGAACCGTAACAACTGAAGCCATTCTCGACTGGCACANNNNNNNNNNNACTTGGCTCACCAACAGTTTGGA
TTAGTGATCAAGGAAGCCGCTTCAGGAACGAGGTGGTGCACGAGGTGTCAAGGCGGATGGGTTGCCAGCAGAACTTTGTCCTGGCGTACAACCCATGGAT
CAGCGGGTCGATTGAGATGCTCCACCGCGATATCGAGCAAGTGCTNNNNNNNNNNTGTGATGTGTCTTGAGGCCAAAATGGACATCCAGGGTTGGACGTA
CTTTGTATCAGTGTTACAAGCCAGCCTTAACCGCACGTCTGTCCCGTCGCTTGCCAATATGGCGCCAGTGGAACTATTCTACGGACTGCCAGCATCGTTG
TTGCTGGACTTTATTATCGATGCCAAGACGGAGGCATTTGTCGACTTGGATGCTGGCTTAAGCCGGTTTGGGCCCAAGATCAACGCCCTACGCGAGATTC
TCCACATGATGCACAGAAGGGCCAACGACGTGCGCCTCGCCGTATCAAACGCAAGCAAAAGAAGACAGTGAAGCCTAACTTCGGGATTGGCGACTACGTA
CTGCGGTGACGTATCGACCAGAAGCACAATGGCAACCTGCTGGTTGCATGGATAGGACCGTACAAAGCCGTCGGTACCGACGTTCACTATTTCGGGTCCG
CCATCTCGTCACAGGGGCTGAGAGAGACGTCCATCCGTCGCGTCTCAAGCCATATGCACACGACACGTACGAGATAATAGAGGAGATAAAAGAGCACATG
GAGGCGCAGGGGATCACCCTGAACCTTGCTGCCCTCGAAGGTCACCAGCGGAACGAGCAGAAGGGCGACTATGAGCGTCTCGTCGAGTGGAAAGGGCTCG
AGCCGATCGAGAAATCGTGGGAAATCCTCAGCACACTCTCCAAGGATCTACCGGAGATGATTGACAAGTACGCAGCAAGTCTGGATGACGAAGGACT