Description :
From Genome Similarity Track
Location :
contig_46:388288- 389327
Transcript NameFunction/comments
g10099.t1hypothetical protein

Sequence
1039 bases(100 bases per row)
CGGTGGCGCGGTCGCACCGAATCGGCTGCCGATCTCAGACTGAGACGGCATCCACGGCTCGCGCACTGGCTCAGTGCGAGGCCGCAACAACAGCGGATGG
AGCAGAGTCATCTCCATCCCGCGGAGTCGTCAAGGCTCCAGCGGCAGCGAGCGGTGTTCCACTGCCGCTGCGCGAACGCTTCGAGCTCGAAGCGTTCGAG
TCGTCCTCGCGTGGACGACGCAGACCCACATTGGGGTCAGTGTGGCCCGGAGACAAGTGTCCTTGTCTCCTTCGAGTTCCCCCTCCTCGACTTCGCTTCC
GTAGTCGAGGGGAACTCCCTCTCCACCCGGAGAGTAGATGCCCACTCCGGTTTCGACAGCAATGATCTTGCCTGTCTTGTTTCGGATGGCATGTTTCTCA
TGCCATCTCGAGTGGTATCCAGCAACAGAGAGGCGACTCTCTGTTGCCGCGCTTGTCGCATCGCCGTCGAGGCGATCAGTAGCGGTCGTGGCTGAGGCAG
CGGCCGTCGTCGCCTTGGAGGCGACGACAGCACTTGCTGTTGCCGAAGCGGCCGGCGTCTTGGACGAAGACGTCGTTGGCGTGCTCATTGGGAATGAGCA
CGTGTTCTCCCGAAGAAAATACGGATTGACGTGTCGAGACCGGCACGTCAAATCCTAACGGGGGGATGGTGTAGCGGGGCTACACAGTCGGTTCACCTCC
TACCTTAGTGCAACATGCACTAAGGAATACATTCAGGTGACCACTCCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACAC
CTTTCTACCAATCAGAGTCATTCAATAGATGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAACATCAGTTTTAGGAGGAAACCCCATTT
ACAATCAATACAGTTCTCATTTGGCACCAAAGCTATCGTTCGGTTCCTTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACTTAAGTAAA
TTACTCCTACGCTTCCTCATACACGTGCGCACACGTGTA