Description :
From Genome Similarity Track
Location :
contig_46:388277- 389316
Transcript NameFunction/comments
g9634.t1hypothetical protein

Sequence
1039 bases(100 bases per row)
TCGCACCGAATCGGCTGCCGATCTCAGACTGAGACGGCATCCACGGCTCGCGCACTGGCTCAGTGCGAGGCCGCAACAACAGCGGATGGAGCAGAGTCAT
CTCCATCCCGCGGAGTCGTCAAGGCTCCAGCGGCAGCGAGCGGTGTTCCACTGCCGCTGCGCGAACGCTTCGAGCTCGAAGCGTTCGAGTCGTCCTCGCG
TGGACGACGCAGACCCACATTGGGGTCAGTGTGGCCCGGAGACAAGTGTCCTTGTCTCCTTCGAGTTCCCCCTCCTCGACTTCGCTTCCGTAGTCGAGGG
GAACTCCCTCTCCACCCGGAGAGTAGATGCCCACTCCGGTTTCGACAGCAATGATCTTGCCTGTCTTGTTTCGGATGGCATGTTTCTCATGCCATCTCGA
GTGGTATCCAGCAACAGAGAGGCGACTCTCTGTTGCCGCGCTTGTCGCATCGCCGTCGAGGCGATCAGTAGCGGTCGTGGCTGAGGCAGCGGCCGTCGTC
GCCTTGGAGGCGACGACAGCACTTGCTGTTGCCGAAGCGGCCGGCGTCTTGGACGAAGACGTCGTTGGCGTGCTCATTGGGAATGAGCACGTGTTCTCCC
GAAGAAAATACGGATTGACGTGTCGAGACCGGCACGTCAAATCCTAACGGGGGGATGGTGTAGCGGGGCTACACAGTCGGTTCACCTCCTACCTTAGTGC
AACATGCACTAAGGAATACATTCAGGTGACCACTCCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAA
TCAGAGTCATTCAATAGATGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATAC
AGTTCTCATTTGGCACCAAAGCTATCGTTCGGTTCCTTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACTTAAGTAAATTACTCCTACG
CTTCCTCATACACGTGCGCACACGTGTAAGCTTAAGTAG