Description :
From Genome Similarity Track
Location :
Scaffold_321:3881- 5756
Transcript NameFunction/comments
g3766.t1hypothetical protein

Sequence
1875 bases(100 bases per row)
CCAACGACTCTCGCAGTCGTTGGCGTTCGCTTGGGGTGACCGGAGACAGCCGCATTCCGCGCTGTCTCTAGTGGAGGGCCGCATGCACCACGTGGTGCAT
GTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGCGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGC
AAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGACGATAAGCTCGTCGACGAACTCCTTCTCTTGATAAGAGAAGCGTACGCGT
ACGATACGCTTCTCGGTGCTAACAACGACACCCGTTGCAAGCCTCACTTCCAATAGACTTCGAGGTGTTTCCACCTCCTCGAAGTCAAGCCTTGGAAGGC
TCTGCAGTCGAACAAAGTTGTTCGACGCACCACAGTTCCACTACAGCACGAAGGCACTTCTCTCACTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCT
TGTCATCTTGCTTCTTGCAGCGAGATCGACTCTCACTGGGGGCAGCGATCTTCAATGAAGCGTGTCCGATGTCGACACGCTCGACCGCATCACCAGCAGG
GCGCCCCGCGCCTGCTGGTCCCTTTGGTTTTTTTATTGCCCGTGACGATACCCAGTATCGCCACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACT
CGCGGGCATAGTGACCGATGTTTCCGCATCGGAAACAACGCACATTCGTTGATATACGACGCTGCTGGGAACCAGCAGCGGTCGCACTCGAGAGGTCCAT
TGGTTCGGGACCTCCCGACGGCCTTACCACCGGTCGTGGCATCAGCCGCGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATT
GCAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTG
TCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAA
CTCCGCCCTCGATCGGAACTCGTTCTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAAATCCTCGTACGTGCTAAAGCACGTAGGATCTGTGAGT
CGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGCAATGGCAG
TGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCCCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGG
CGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCTGTCGGCGATAGCGTTCGCAACATCGTT
GCTACCGCCGCTTCCCCAATGACTGTTGACAGTCATTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGTACGCACAACATGCGTTGCAG
ACGTGTTTGGGCTACCCACAGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGAC
TACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTATAGAGGAAGTGTAGGAGTATTTAACTTAAGT
TCAGTATACTTGTATCCACAAGTATACTGAAACCTAGATAAAGGAACCGAACGATAGCTTTGGTGCCAAATGAGA