Description :
From Genome Similarity Track
Location :
Scaffold_128:388- 2775
Transcript NameFunction/comments
Phyke_g4535conserved hypothetical protein
Phyke_g4536hypothetical protein PHYSODRAFT_480606

Sequence
2387 bases(100 bases per row)
GGTGGCTCCGGCTTCTCGTACGACCAGGTGACGGACATTGCCACTTGCTCGAAGACCCCGGTGACAACCAACAACCCCGTGTCTCCGTTCGATGTGGACG
TGTCGCTCGCTTTCCGTGGACCCGCGACCATCTACAACATCGGTGTGTTCACCAACGTCAATGGCACGTGGAACAAGGTCTCCTCGTACAAGAACGGTGG
CGAAGCCACCAACATGGTGTTCttgaacaacaacaacattgaTTACGGTGGTCAGGGTTCCCCGGAGGGATTCGCCAAGGCTGACGGCACGGGCGTTGCC
ACGGAGTCGACCCCATTCAGCGGCACGCTGGCATCGGCCACGGACCCGGCCGGCCAGTCCATCCTTGCGGAGGACAAGACGGGCGCTGAAGTTCATATCA
TGACGGAGCAGAAGTGCGGCGTTGACGCCGAGTGCCCTGGCGCTTATGACAATGACGGCACGGCCTTCCTGGGCTGGGACGGTCCCAAGAAGATCTTTGT
CTTCACGGTGTCGATGGAGCACGGTGGCGCACCGGACGTTCCTGCAGTATGGATGCTCAGCGGCCAGAGCATGCGCTCGGGCCAGTACCAGTGCAACTGC
CGTGGTGTCGGCCCTGCCGGTGGCTGTGGTGAGCTTGACATCGTCGAGGTTCTAGAGAAGGATACGAGCTTCGTGGCAACGCACTACTACTTCTACGACG
GCACGTACAACCCGGGTAACGACCAGTTCGCTCAGCGCCCGACCGAAGGCCCGGCCACTTACGTGACTATCATCGACGAGGCCTATGGTGTCAAGGTGCT
CCAGATCGACAATGAATCCTTCGACTACGGCTGCGGCTCCATCTCGGACGACGTTGTGTCGCAGTGGGAGAGCGCCGAGTAAACTCATTAAGAGTTTCTC
ATTGTCTATAACCAAACTTAATGCTTTCATGTTCCCTGATCGTAGGGTAGATTGCAATACAGTTCTTTGACGTCATAATTCTTCCTTATCTTTGTCGTGT
TTCGTGTGGTGTCTAATCGCTGCGTGATGGCGGCCACGAAAATTGTTGTTTTCTACTGGACCGAAGTGAAGTCAATGATGACCTTGGAAagctggagttg
gtgctgagcgTATTGGACGCCGGCCATGTCCAATAACCGCCGCGATGCCACGAACTTCCAGCTAGAGTGTAACACAACAACTCACGATAAGTGATACTGA
CACATTCATCTCAATTGCAAGCTGTTGTGACAGCACACGTACTCCTTGTTGTATTTGTCTGAGCAGTAAACGACGCGCGAGATGCCACTCTAAGCAAGTA
AGAAGAATACAGCAACCAATATTCAGCTCAACTCTTCAAGGCAAGCACCAGGGAAATGCAAATACCTGGATAATGAGCTTGGCGCATTCGTTGCAAGGGA
ATAGCGCCACGTAAATCTGAACGAAAGCACAGTGTTAGTCCAGGAATATGTAAGTTGGACGGACTCGATTCGTACCGTGCATCCTTTAACGTCAGTGGAG
TTCTTGTTGAGGATCGCATTCATCTCTGCATGACAAACATACTGCAAAACCGAAACACTTAGTCGTGGAGACACCGAGTAGACAATAGCACTCTAGCGTA
CCGGATACTTGGTCTCAAGGGGTGATTGCGTTGCACTCTCACGAGCCCACGGCAAATTGTCATCGTCACAACCGTTGGGAAAACCGTTGTAGCCGATGCC
CACAATCTTCTTCTCGGGGTTCACAATGCTACCACCCAATCACAGCAGTAAGTATCATCAGTCTCAACATACCAACACTTTGCATATTGTGGTCATCATA
CCAAGCTCCGACTTGAGTCGACGGATCTACACAATAAAAACACACACAGTCGAACTCGAAGCACATCAGTTCAAATCTACTAACCCCCACCTCACTAATA
CTGATAAACCTTTACCTTTCGAGCGCATCGCGCTGAGGAACGCAACACTCATAAAATAGTCATCCCACGACAAATAGTCTGTGCGTTTGTGCACTGTAGG
TTGAGTACCAGTAGCCTCAGCCGTATGCGCCTCTTGGGTGTCCTccacgctgctgtcgctttcATTGGAgccttcactgctgctgctgccaccgccgctt
GTATCTCCTCggatcttggccttcaacTTGCCATTTTTCTTCTCAGATGGAGACTTGGCAttggcaactgcaactgACGGACTCACGTGAGCTTCGCGGG
TCTCAGCCGCCACCCACTCGGGATGTTTCACCACAACGTGCTGCACCAGATTAGTGTAGCCATTCTTGAGTCTCTGAGACCGCGTCTTGCCACACTTGCA
ACGGAACAGAGTAGCTCTATCCACCTCGTCTTCGATACCGTCATCTTTCAGCACTTCCGTGTAGAACAGCTCCATGATCTGCCGTCC