Description :
From Genome Similarity Track
Location :
Scaffold_450:388- 2703
Sequence
2315 bases(100 bases per row)
AAGAATTTGAGGACGTCTTCCCCGACGAGGTACCGTGTCGCCTCCCAGTCGACAAGGGCGTTCAACACGAGATTGACCTCGTGCCCGGCGCAAAGTATTG
TGTAACGCGGCAATGGCCGCTTCCTCGCGACCAAGTCGATGCCATCGACGCATTCTTCGCGGCCCGCAAGGCGGCGGGTCACGTCCGCGAAAGCATTTCC
CCTCACAGCAGCCCGACCTTCTGTGTGAACAAGCCCGGTGGGAAATGGCGTATTGTGCACGCCTTAAACAAATTGAACGCAGCCACGATTCCGGCTCAGA
CGCCGGTTCCTCGCAAGGACGTTATCATCGACAGCATGGGTCGATCCACCATTTTCTCCACCATCGACCTTCGCGATGGCTTTTACCAGATCTTGATGCG
TCTATGCGACGTCCCAAAAACGGCGGTTTCTACGCCGAGAGGCATGTTATGGGAGTGGCTGGTCATACCACAAGGTCTGTCCAACGCCCCGGCGACGTTC
AATCGTATGGTTACCGTGAAGTTCCGCGCGTTTCGCGACTTCGCACCGTCGTACTTCGACGACATTTATGTTCACAGTTGCGCCTCCTCCACGCAATCTG
ATCTTGACGTTCACCGCGGCGACCTCCGCAGGGTGCTTGAAGTCCTCCGTGCCAACGGACTCTATGCCAACCTCGCCAAATGTATGTTTGGCATAGACGA
AATCCCGGTCCTGGGAGATTTAGTGGGGGTGAACGGATGTCGGGCTGATCCCGAAAAGATCAAGACCATTTCGGAGTGGCCTATCCCCTCCTCAAGGATC
TTCGTCGCTGGCTGGGCCTTGCGACGTACCTGCACAAATACTCGCAAAACTTTGCGGACATCGCCCAGCCGTTGTTTCGGCTTCTCCTCAAGGACGCCCC
TTGGGTTTGGGACTCCGCTTGTCAGGAGGCTTTCGACGGCCTCAAAATCAACCTTCAACGCGCCCCGATCTTGGCGCTCCTGGACTTTGACAAACCTTTC
TCCGTCGTTTGTGACGCTTCGCAATTCGAAATTGGCTGCTGCCTAATGCAGCTCGACGCCTCCGGTCACCCTCGCCCGGTCTCCTACCAAAGCCGCTAAC
TTCACGCGGCTGAGCGGGCGTACCCAGTCCACGATTTGATATTTCTCTCCATGAAGTACGCCCTGACCAAGTTCCGCATCTACCTTCTCGGCGGTAAACC
CTTCGTGATCTACACCGATCATGTGTCCTTACGCACAGCGATGAACACGCCCCACCTTTCACAGCGCATGGCACGCTGGATTTCGTTCTTCTCCGAATTC
ACATTTTCGGTACAGTACAAGCCCGGGAAGGACAACATCCTGGCCGACGCCCTTTCTCGGCGTCCTGATCTCGAACTGACCACGATCGGTCTTTTAACGT
CGGGTCTTCACGATCGAATTCGTGCAGCATACCCCTTTGACGCTGACTGCTCGTCGCGCCTGGCGGCGCTCACCGACCCCGTTTCCACCAAACCCCGCTG
TGCTTCGTCGGCCTTACACCGCTTCGCCCTCGCCGATGGGCTTTTGCTGCTTCAACCCACAGCGGACTCACCGCCGCGCATTGTTGTGCCCGGTAACGCG
CAACTGCGCCTCACTCTCCTTCGATCCTACCATGACTCCCCCAGCGGCGGCCATTTCGGCCGCGACAAAATGCACGCGGTCCTGGCGCGTTCATACTGGT
GGCCCCGCGTGTATAAATTCGTTGTGCGCTACGTCGCTCATTGCGACGCTTGCCAGCGCACTAAAATCACCGCCTCCTCTCGAGCTCCGCTCCAACCTCT
GCCTATTCCCGACGAACTTCGGTCGTCCGTCAGCATGGATTTCATGTTTGGCCTGCCCCGTGACGCCCGTGGCAACACCGGCATTATGGTTTGTGTCGGC
CGAGCGTCGAAGTACGTTATTGTCGTCCCCGTCCGGGATACGCTGTGCGGTGCGGATGCCGCTCGCCTCTTTTTCGATCACGTTTTCTGTCGTTTCGGTC
TGCCCTGCTCCATCGTCTCGGACCGTGACCCGCGGTTCACGGCGAAGTTTTGGTATTCCTCGCTCGATATGTCAACTTCGGATCACCCCGAGTTCGACGG
CCAAACGGAACGCGCCAACCGCGTCCTCGAAGATATCCTCCGGAGCTACTCCGTTTCTACCGGTTCCTCGTGGGCTGTCGCGCTACAGCACGTGGTTTTC
GCTTACAACGCCTCGGTTCAGGCGTCCACTGGCTTTTCGCCGCATTATGCGGTCCATCTCCAACACCCCCGCCTCCCTCCTATGCTCGAGGGTTCGATTT
CCAGTGGGGGTGGAG