Description :
From Genome Similarity Track
Location :
Scaffold_1902:388- 1640
Sequence
1252 bases(100 bases per row)
TTTCTCTTGAGGGTTTTTAGTGCTTGGTCCGCGACCCTCAAAGTCGGACAAATAAACCTCCAAACATGGTAAGAGTAGTTAGAAATACTACAGAATAAAA
ATAGGTTTGACATCATAGAAAATGGGGGATACCCACGGGACTGCGTCAAACCAGATGATCCATACGTTAATATTAGAATGGCTACTATGCTCTTCGGCCG
GTCGGATCTGTTAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGGTCCACCAGGAACAAGTGGCCAGATTTGCTGCGCAGTTTCCAGACCCAG
TACTGTGGATTGGGAGTGTCGGTGGCACGACAATACTACCATGCTCGCCGCAGATCGGATGAATCCCCGCTAAAATACCAGCATCGACTAAATGTGGCCG
GTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTACGCGAACATGTGGATCATTTCATCGAGACGCTGGGAGATGTGGATCTGGCCGA
CAAGCTGACCCTGTTACGACTTCCCGACGCAGACGAGCTTGAGGAAGTGCTGCGGGCTGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGA
TCCGGCAAGTATCGCCAAAAGGCTCCGACGCCTACGGCCCCAACTCGACGTGTCCACCAAGTCACGGCGCCCGACGCTGGAACTGAATCAGGATCCGACG
GTTCGGACTCCGACCCTGAAGATAACCGTCGAGTCTGTCTCACTGCGTCCAACGATCGAACGGCGAAGACCGGAGACAGCTCTCGACCCGAGGATACCGT
ACCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGGCAGCACAAGTCAGGTGTTCACAGTCCGGATCCCGGAAGCACACTGAATCTGGA
TGCTGGAAACACCTGGTCTGTGAGAAGTGTGGCAAGAAAGGCCATCCCGGGGATCATTGCTTCTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCG
GCAAGTGCCCGATGGAAGAATTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCACCGAGGGATGTTGCCAGAAGTGGCCGAGAAGATATTAAA
CTAGGACGCTCGCCGGGTTTGAATACGGTACGAGCCGAGCGTTCTAGGTATTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCCAGGTAGCAGGA
CCCTAGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAA