Description :
From Genome Similarity Track
Location :
Scaffold_10:388- 1512
Transcript NameFunction/comments
Physo_130043pol protein

Sequence
1124 bases(100 bases per row)
TTCACCAAGCGCGAGGGTCTTAGACGTCAGGTAGTCTGCGGCCTGGTTAAACTCTCGCTTGACGTGCACCAGCCGCACAGACTTGAACTTCAGCACTTCA
TACTCGGCCAGCTTCCTCTGGAGATTTGGCTGATTGCAGTTGATGAGACCCTGGGCTTGCTGGATGGCAATCCTGGAGTCCCCAACTACAACGATATCCT
GAATCCCACGCTCAATCGCCAGAATGAGGCCCTTCAGAAGTCCATAATACTCAGCGTCGTTCACAGTCACGTCCTCCAGGATGAATCCCTGGGCATCCAG
GATTTCCCAACCGGGGACGTGCCACAGAATGCAACCACAGCTCCCTTGTCGCGTGGAAGTCTTAGCGGCGCCATCGAAACTCAGAATACACCCCTCATAA
TCCGCTTCCAGCATTTCCATGCTGATAGGCACTGGAGGTTTGACGCGCCCTTGGCTGGGATCAGGTTTTCAGCGATCTCATCCAAGTGTTCTCTGGGGGT
AATACCCGCACCCAGAATTGCAGCCAAGCCGTCTTCATCTCGTTGAACTCTGCGTATCTCCAGGTTCCAGTGGGACAACTTCAGACCCCACTACACCGTT
CGACCGTCTGCCGACTGCGAAGTCAGCAACCACTTCAACACAGAGTATCGCGTGTAGACAACGATCTCAGGGCTGCCTTCAACCAGAGTGCGAAACACCT
CCAGGACTCTCAGGATAGCAATCACCTCCTTCTCCGCAATGTGATACCGCAGCTCAGCGTCATTCAGGACGCGACCTGTGAACCGAACCGGATGCACAAT
CCCGTCGTACTCCTGGTCCAACACAGCGGATGCTGCCCACGGGTTCGCGTGGGGAATAATCACGAAGGGCCTTGAACGATCCGGATGTCTGAGCAACGGA
GTCGAAACAATCTTGCGCTTCAGGATTTCAAAGGCTTCCTGGGCTCTCGACAGGTCTCTCCTGAATTTCACTTGTTCCTCAGTCAGCTCGTACAGGACGG
CCGCGATCACGGGTAGGTCTTCAATGAACTTGTTGTAGTAATTTAGACTCCCCATGAAACTCTGGACACCATTCAGTGTCGTCGGGAACGGCAAGTCTTG
AACCCCCTTCGCGATTTTAGGGGT