Description :
From Genome Similarity Track
Location :
Scaffold_2727:388- 1485
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_2727-snap-gene-0.1Gene of unknown function
Pytir_DAOMBR486maker-pir_contig_2727-fgenesh-gene-0.0Pectin lyase

Sequence
1097 bases(100 bases per row)
CGCCGGCTTCTGTGTGTTGAAAATTGAGCGTGTGGTCAACAGAGCACGTTCCGAGTGTTCTTTTGCTATTTTTGTTAACTTGTGATTGGCGTGTTTGGAC
AATTGCACACTTGTGGATCATAATAAGTTGTAAATGCAAGATCGGATCGAATCTTGAATTGGGTATTTGTTGTGAGTGCTGATGCTCTGGTTGTCCAAGT
GGGTTCTTGCTGTGTGCAAGGGAGGGAGGGCTAGTCGTTTTACCGGAACACTTGCTTTTCATATCGTCGAGCATTGAAATGCGTTTCGGCGCAACACACC
ATGGCTCCCTTGCTATCGCTTGGATCATTCTCAGCTCCCCGCCCGGCCTACAATTATGGACAGCAACAAAGGACCAAACACAGGGGTGCCCCCCACATCG
CAAAAGTAGCACATGACGCGCAAAGAACGTTCAATAAGACAGCAAAACGTGGGATTGTGGCACCACCGGAGGTGGTAACGCAGCCCCGGTGTACCCGACG
ACGATCGAGCAGCTCGGGTCATAGCTGTTGGACAGCCAGCCCCGCGTCATCGTCCTCAACAAGGCGTTCGACTTCCGCGGCTCGGAAGGAACCAAGACCG
AGATCAGCTGACACCCGATTGCACATCGGAATTGTATTAACATGAAGAATGGGCACAAGGGTCAAGACGTGATTCTCCAAGAAGGCGGTATGAAGAACAC
TGGCGGTTGCGACGACGGAGTGCCTCAGGAGGTGACGTACGACATCGCAGCCACCACGAACTGGATTCTCATCTGTGACAACAAAATCCTGCGCGGCGAC
GGCCTCAAGGGAGTGATCATCGGCAAGGGCATCTGGGTCCAGGGCAATAACGCCATCGTCCAGAACGTCCACATCACCAACCTGAACCCACACTTGATCT
GGTGAGGCGACACCATCTACCTCCAGGGAACCACCGCCGGCGCCACCCAGGAACGCGTCTGGATCGACCACGTCAAGGTCTCGCTCATCGATCACCAGAT
GATGACCGCGGACGCCGCGAGCTCCAAGACGCTCACGATCAGCAACTCCGAGTTCGACGGCGAGACCCCGTACTCCGCTACGCGCGACGACCACCAC