Description :
From Genome Similarity Track
Location :
scaffold_45:38799- 41855
Transcript NameFunction/comments
Pl_111226hypothetical protein PHYSODRAFT_332092
Pl_111227hypothetical protein PHYSODRAFT_544179

Sequence
3056 bases(100 bases per row)
CGCCATCACTGATGAATTCTTCATACTTCTCGATATTCTGGTCGATGAAATTGTAGCCGAAATCCATGAGACCCACCTTGTCAGCATCCGACAGGGAGAG
CTCATCGAAGGGGTTAACGACAAAGCGGTCCTTGCCCATGTTTGATCACTCGAAATTATTAACGTCTCAGTTTGGACGCGAGGGAAGAGTACTTGCTGGA
AACCCAGCAAATTGAGCAATGATAGTTGTAGCAGAGGCTGGTGGTGGAAAGATTGTGGGGTAAGCCTGGTAGGAGCCTACTCTCGGTGGGTAGGCTCCTA
CACCACCATAGGGCTCCGAGTATCTTAAACTAGGCTCGGGGCCTCAAGAGGAGTGTTTTCACCTTGATCCTAGTTTTAGAGCATTCCTATGTGTGTTTTC
AACAGTTTTTTCGAGAACGGTTTGACTTCAAGATGCTACGATGGTCGAAGTTCAGGGAACTAACGCAACCGCCTCTGTCGCGGAATACATGTTTTGAGTT
GTCAGACTTCGGAAGCGTTCCAATCATCAGACGTCGCACAGTATGCTGAAATACCAGTTGGGGTTTAACACTTGGTAGTGCCCCAGCTTGCTGATCCGAT
TCCGCTGTCTGCTCCATAGCGATGTAATCTCATATTTTATCTAGCAGCAGGAAAGTAATGCACTTTAGCCAATTGACGGCTTGGTAGGATCAATCTGACG
GCTCAGGACTGCATGTCTTCTTTAGAGCTAGGAGCTCGACAGCATTCCCGATGCTACCGAAAATTATCGAGGATAAGATCTCAAGCAACTGTATCCGACC
TTGGCCTTAGATAGACAAACAACAAGTGCGTTTGTCATGGTTGCCCCAAACTTGACGGGTACCCCATCACTAAAACTCATTTGCAGATTTCCGTCGCCAT
CATCACCTGAATTGAAGTCAACTATGGGCAAGAACCGCTTCGTAGTGAACCCTTTCGGTCACCTCAATCTCTCGGAATTCGACAAGTCCAAACTGAAGGA
GTTCGCCTACAACTTCTTTGACCAAAGTGTCATGAAATATGAAGCATTCATCGGAGACGGAGGTCCGAAGGTTGACCCGAAGGAATGGAAGTTGATCAAG
GTGAAAGATGACACCCGCGTCTACCTAGAACGCGACCCACCCGTCCGAACATCAATTTCGGGATCGGTCTCGGATCACCCTGCTCTGCTTATGACGGGTA
TCACGTGGGGCACAGTTGAGGATTGCATGCACGGCGCATACAGTCCGACTCTCGAGACAATGCGAATTAAGGCCTCCTATGTCGAAGACATGAGCGGAGG
TGCTGTATTAGCAGTGCTTGAAGAACCCACCCCTGAAGACCCCTTTCGTTCGATGACAATCAAGTGGATCGAGCTCGATCTACCTTTTAATTCCACCACT
TTGGTTAAGAATCGAGACTACGTGTACATCGAGTACATGAAGACCGTCAAACTGTCAAGTGGAGAGTGCATCGGTTGTCAGATGTACCACTCGGTCAATT
TCCCACAAACCAAGGAGCTCCCGAACCGTGTACGGGCGAACATGACAGTCTGCGGCATTTTCCGTCAACTTGGTCCAGATACAGTGGAAGTGTATGGCTC
GGGGATTGTTGACCCTGCCGGTGATATGATCAAAGCATTAGTCATTCCTAGCATGGCTACAGGTTACCTGACTGTGCTCAAGTATGCCCATTGCAGCAAG
ATGAAAAAGATTATTTGGCTGTTAGGTAAGCGCTATGAAATGGCAAAGGAATTGGGCGCGCCTGGTAAAGCTCACATTTGCGTCACATGTTGCACACCGA
TCTCAAAACTTCGTCGTGGAGACTACGGCAGGAGCGAGGGAAGCACGTGCAAATTGTGTGTTGGATATTTGTGTCGCTCATGCCGAATCCAGCGCAAGTT
GACTTTTACAAGCTCGGATCTTCAGATGGAGCAACGCAAGGTGTCATTTTGTGGGCTTTGTCTTCAACAAGCTCGCACCATGAGTCCAATGGAGATGATC
AGAGAACAAATGGAATCGACTCGCAAAAAGAGAGCGTTGACAGCGACTTCAAATAGTACCATCGATTCTTCCTCAGTCAGCCTGAGTGTTATACAAGCCC
TCAGTCGGAGTACCAGTCAACTGGATAACTTGTGCGTAATGGCCAACAACGCAATTTGCACTACAGCGTGTCGAGACCAACTCCCTGAACATAATGTACC
CCACGAAAACAAAAGTGAAGCTGTTGTGTGTTCATTCATTCATGGTCAACGGGAAGCTTCATATCCTTTCTGTCGTTGCATCTTCTACTTCATTTTCCGC
AGTGCTTAGAGCAGTAGTTGTTGTTGCGCTCGTAAGCCACTGTCATACACCCTTGGTACACGCAGCGCTTGCCACCTCCATGGGCCCAGCACAGACTGTT
GGTAATCGCAATTTTTGAGCATCCGGCATGAGAGCACTTGGTGCCGCCTCCATGAGACCAGCAGAAACCTCGTGACTTGCCTCGTCGCGGACAATTAGCC
ACTTTACACATCACCCACCCACCTGATCCAGAAAATATTGGTTAGTACTTCTTAACGTACGCAATGCACCGGCATGAACGTACCGTGGCGCCAGCACAAA
CCAGCATGTTTAGCACTTGCTTGACACCCTTCAGCAGAACATTTCCTGCCACCCTGTAGGTTATTACATAACGTTTGACACGATGCCGGTCATGGATCGA
GAGCCACAGATCAGAAGGGATCTAGCTTGTGAAGACCAAAATGCCCTATTACCCCATGACGGAAGCACAATCCCTTCGCTACGACATAATTTTCACAGCC
TTCGCTCTTGCACTCTCGAGCTTTGCGCTTTTGATCTTTTGCCGCAGATCGATAACACTTTCTTGTGTTATTACTCTTTGCCCCCACAACAATCGTTGTG
GCTGTGGTATCCATGGAAAACTCACGATCAATTTCATTGGTATCATCCGACTTGTTCATGATGAATTCCAATGAAGCTTTGTTGAAAATCCGCATCGTGA
CCACCGCGAAAATTGTAGACTGACGTCCCCCGCAAGAGCAGAGGGTTCATCGAGAG