Description :
From Genome Similarity Track
Location :
Scaffold_9:387970- 390393
Transcript NameFunction/comments
Aphas_H257_05382Hypothetical protein
Aphas_H257_05383Hypothetical protein

Sequence
2423 bases(100 bases per row)
CGACGACACCAAGTTCAAGGACGCTTTGGCCACGTATGTTGCGTATATCGCCCACATTCGCCAAGTGGCAGCGCGACTCGACGCCCAGCGGGTGGCTTTG
CTCGCGTTCGATGCAGCTTCGACGAGTTTATTCGACATAACGTTGCCACATGGCACCTCGCCTTTGGACGCACCCGCCCGCTCCATTTTGGTTCGTTCAA
TGTTATGATCATTGAAAATCCCTAACGTGGGTACAGGATGCCACGATGACAGCGGCGGTGCAGGCCTTAGACGCCAAAGCAAAATCCCTTGCAGTTCATG
AGGTACTTACTGTATGTAACCAAATATGTTGACATAAATATAATCATGTTTTGACATGATGCTTATTTATTGCGTTTACAAGAAGTATTAATACTAACTA
TTACAGTAATAGAAGTAGTACCTACTTTTACATGAATTTGACGAAATGTGGGCTAGGATGTCATCCAAGCTCGAGCAGCCGCCAAACTGGAAGTGGACAG
CTTGTCCCGCATCAAGTCGAGTCGAGTAGAGGCTGCGACCGCGCTTCTCGAGACATTAACCGACCGCCTCTTTCGCCAGTTTGCCCTTGTCCAAGCGTAT
CGACATGAGTTTATTGCAGACGAGGTGGCCATGGTACATACATACGCACCTTTCAATGTCAACAACATCCACCATGCACTGTCATTCCGTTGATCCGCTA
GCTATGCCGCCATATGAGTCAATCATCACCGAGTAAAAGTAGACTAACTACGTTGATACAGGCCCAGCAGGCAGTGGGGGTGTACGTGGCTCAGTTGTCA
AGTACCCCCCTCTTCCCGAGTGAAGAAGTCTCATCTGAATCGTCAAAGCCTGTAATGTCACACATTCGTACCAAGTGCATACCGTCGTCACAACATTGGT
TAGCACTTGGCCACGTCTTGGACTTCCGAAACCCAAACAAGTGCATCCACTTCAACTGAAGGAGAGGCTAGCGACCGCCTCCCACGGGAACCGAACGCGA
CTTCGTTGTCGGTCGTGCCACTGACACCACAACAGGCGACTGTACCCACCGCCACCCGCCTGCGCGTTTCAAAGTTGACAGTGAGCCCATTCCTCGCTAA
GTTGAAGCTGTTATCCACCCAGCTCAATCCCCATACTATTTTATATAACCCAGGTATTATTGTTATTACCAGTTAGTTAGGTTCAACTTCCCATTAACAC
CAGTGCACAGGACAACCAATCCACGACGACGACGGCACGACCAATCAAGTGGACGACGACGAATACACGCTCGATATGACGGCGTCCGACCAGTGTGTCA
TAGGCGGCGGCACGAACCAGTCTCTCTTACTAGTGTACAGTGTTCCCCCCAGCACTTAAAAACAAATCAAGCCATCAACAATGACGTGGCACCTCCGTTT
GGTTATAAAACCCTGTCGCACACACATCGTCACATTCAGTCGCACTTGGAGTTGGCTCGCGCTTGCGCAGCGTCCGCCAACGCCTGCCAGTTGTGCTTGA
TCAAGACATAGGCGCCACACACCCCTGCAAATGTGTAGCCCAGCGTCATGCCAATCCAGAGCCCGGGAAGCCCCCAGGCGAAGGAAAACTCAAACAAGTA
GCCCACGGGCAGGCCAAACAAAAGGTACGACACGAAGTTGATGGCGGCGCCGTAGTTTTGCAGCCCGCAGCCCCGCAATGCGCCCTGGATCGCAGCGTTG
AGTCCGTCCACGAGCTGAAACCCAGCCACGACCACGGCCACTTGGGCCGCTAACCTACCCTTTCACCATGTTAACCCTATTGTTATGACCCAAGCGGGGA
TGGGAAACGTACGCAATCATAGCCGAGTCTTGGGTAAATACGCGCGGATACATGTATCGAAACGCAAATACACATAGCCCCGTCATGACGGACACGCCGC
CTGCGAGAATCGTTGCGACGGCCGCGGCAACCTTGGCGCGCTTAGGGCGGTTCGAGCCGAGGGCATTCCCCACGCGAATGTTGCCGGCGACGGCAATCCC
CAGGTAAAACATGTACACAGTCGCCGTGATATTGACGAGCACGGCGTTGGCGCCAATCGCGACGATCGCGTTCGGGAGCAACCCTATTGATCGTGGTTTC
ATGCGACACCGTCGTGACAAAAAAAATGTGCGACACTGTACCTGCCAAGAGCGCAATAATCTCGTAGCTCCACCATTCAAACACCATCATGAGCATGCCC
GCAAGGCCAAAGTAGACAAACTCGGGCACGCCTTGCACCGCCGCGTGCAGTTGCCAGCCCGGCCAAAACGCCAACCGATCCTTCTTATAAAAGTACGGCA
CCAGCGACAGCGGCAGTGACATGTTCCCCAGCGTCCGGCTGATTGCCGCACCAAGGTACCCACAGCTCGTGTGGTTCACCAACACATAACCAGTGACGAG
GTTCACCATATTGCACAAGATGG