Description :
From Genome Similarity Track
Location :
Scaffold_163:38797- 41467
Transcript NameFunction/comments
Physo_144038Avh_248
Physo_159204PsAvh248

Sequence
2670 bases(100 bases per row)
TCGGCGTGGACAGCGTCGTTCACCCCCGCGGGAGCCACTTGGCCCAGCTTGTTCTGGGCAGGCGCCGAGATTGCGTCACCGCTTACGAGGAGAGTGATCG
CGACCAAACAAAGGAGCAAGAACTTGGTCATGGTGTCGAGGTAGGAGGAAGAGGAGTGGTTGTCTTGTTCGACGCGATTTGGAAAGTGAGGAACCTTGTC
ACCAGGGTCGCCAACGTCGTCCGCTACAGTATCATAGCCACCCGTCGGGTCTTCCAAGATGCAGCTTACATGTTCTGGTCCGCAAATCTTAAGCTTCGAG
GTGGGAAGCAGCCACCTTGCAAGCACCCGTACACATGTATTACCATGTATGAGGTTAGCACACATACTGTTGGATCGTAATCTCGATGCAGTGCAGGCCC
TGCACCGCAGGCAACTCGGCGAATAGAGAGATCCACACCTTCTACGAGCCCGAGCCCGTCTACTTCAAAAGTGGGCTCCCCCTAAAACGAGAGCCAAAAG
TCGCACAAAATGGACTCCCTCATGGTAAGTACGAGATCAAGGAGCCCTGGTTCGGGCTCCCCATTGGCTCCCCTCCAGGGCTCCCCAAATTTAGCTTCAA
ATCTATGACGGGCTCTTCATAGTAATATCTGATTGGCCAATTTTACCTAGACTCAAGGCGAGCAACTTCGCGTGATCGATGCGCCACGCTAGAAGATCGA
GCTCAAAGATCGCCACACTAGAAGATCTCGCGCCGCTCATATGTGTACAGCCGCTCCGAGGCCACCCCAGCGTCGCCGATAGTCCTTCCTTCCCCTCAAG
GAGAAGCCCTCTTTCCTATGCCTTTTCAGGTTAGAACCTGGAGATACTTCAATGACGGCCAATCATCAGCGAGATATTTAACACAGGTGAGGGGAGCCCT
TAACGAGGGCTCACAGTTCTGGAGGGCTCCTTTCACTTAACCTATTGAACTCAAGAGCCCAGGAGCCCGAGCTCGCGACTTTTTGGGTTCACCCAAGAGC
CCAGGAGCCCGGCTCTGTGGAGAGATCTGTCCGTCTGCGTCACACCCTGTCCACTTTAAAGGTGGTCCACATAATCGTACTTAGGCTGCCGAGCGAAGCG
ACGGCGGCCCCGTCGCCGAAGGCGACCCCCCCCCCATACGATATTGCGTGGCCGCAGGACCCGCCCCGGCCTCTGTATTTATTAATTAACGTAACCGTGC
GAGTAGTGCAGCGAGCCGACGAGGCGAGCGGAACGGGTGCATAACAACTAACTACAATATAAATTCTATCCGCCGCGTAGCGGCGGCGCTCGGCTAGTCG
CCTCCGTACATGTAGCACGGAGTCCGTACACATCAAGAGAGGAGTCACCGGACTGGCTCTCCAATCTGGTCCTGACAGGACTCCTGCGACTCAGTACAGT
AAGTGAGCCTCCGTCAGTCACTAACTCAATGGGGCTCAAGGCTCACGGCCGAGGTCCTCCCTCGGGCTGGATCTCCGGTCGGGACCAGATTGGAGAACCA
GCCCAGAGTAATGCCAGATTGGTTGGGAAACCAGTAATTAACGTAAATTCCCAAATAATACCCCGTACCCGTATAGTACCCTCTAAAACGTAACCCACTG
CGTAGCCCAGGGTTACATGGTTACTTCAATTCAAATATCAAGTATAATTTTGTGGGCTTATTGTCGAAAGCATATTTATGCATATAATATACGTAATTTA
TCAGATTTTGTTTGAAAACGCGAGGGTGCCCGGGGTATTATTCGGTAATTTCCGATATGTTCCCGTAAATTAAAAGTGCATCACATGATCAAACTTTGTA
CAGTGTACAGCGTACGAAGAATACATGGCTGCCTGGCGCCAATGTTGCACCTTCTCCTCCGTGTTACATGTATTATACCAGCTTAGCCTGGTAGTCGGCC
CGAGTACATGTGCAGTAGTTTGATGAGACTGGGCCTCAGCAGCCACAGAACCACGGTCATACAAGAAGTGAGATATCCCCGCTGTACGTTTTTGTACTGA
TGTCGCGCTCGATAATGTCGTTAACGAATCACTTGGTGTTTGTTATCACGGGGTTTACATGGGCAACGACGCTAGATGACCCCATGTATTGAGACTGCTG
CATCTCCTACGAGCGGACGAGAATGAGATTGGATTCCTAAATTCCCCGTCATTGTTGTGAGTGACCAAGCGAGGACGCTGTGATAAAGAGCAAGGCTAGT
ATCCCGCAAACAACACGAGCAGAAGATGCCATTTTGCGTCCGCGACAGAATCATTTGTGGAGTTGGACTCTGTTGCCGCTCGATATAGTTTGCTGGCCGA
TAAGTACATCTAACAGAGCTGACGCGAATACATCGGCGCCATTTTCGTATCGTCCAGCAACGTCAGGCTCGTGAACGTGTTGACAGACATCAACTGCGTG
AACTTGCTGCGACGGTGTTAACTTCGGTTCACCCAGATTAGCTTGGGTGAGTTCCAAGCAATGTAAGGCGAAACACTGTTGTTACGCATATGTTTTGGGC
GGCAAAATGGTTCGGTTGTCGGAAGCCGCGCGTGAAAATATACACCAAAAACTCGGTCTTCTGTCCGCAGCTGCAATAGCACATCGATCGATAATGAACC
AAACGCAGTCGCAGGCCGTACAAGGAAGTAACAGTCACGAAGCACCCCCCTAAGCGTGTTTACAGAATAG