Description :
From Genome Similarity Track
Location :
Scaffold_344:3879- 6159
Sequence
2280 bases(100 bases per row)
CGGAACGCGGGGGTGCGTGAGGCTATTCACATAGAAGGGAGTAAATCCGGTCGAGGCATGAACAGCGTTGTTCAACGCAAACTAAATGATAGGGAGCATC
GAGCTCCAAGTCTTAGGCGACTCAGCACAAACACTGCGAAGAACGTCGCCAATGACGCGGTTAACTAGCTCAGTCTAACCATCGGTCTTCGGATGATCCG
CTGTGGACATGTCCAATCGCGTGCCAAGCACCTTGAAGATGGAAGTCCAAAACTTGCCTGTGAAGCGAGGGTCGCGATCAGAGATGATTGCTAGCGGCAA
CCCGTGTTGACGAAACACACGATCGATAAACAGCATAGCTGTACCTTTGCCATCGATGGAATCCGGCACCGCCGCCAAGTGAGCCATCTTGCTTAAACGG
TCAACAAAGACCACAATTCCCGTATAGCCGTCACAGTCTTTGGGAAGACCAAACACAAAATCCATACTGATGGACTCCCAACACCCCGTGGGAACAGTTA
AACTGGCGAGTGGCGCAGCCGAATGTGCTGAAGGTTTGACCCGCTGGCACGTTTCGCATGTACACATGTACGTGCTCACCCATTTGTAGAGTTTGGGCCA
CCAGTAGTGTTGACTCACAGAGCCATAAGTCTTTTCCTGGCCCAACGCCCAATGCCCACTGAGGGCAATATCTTGGGCCTCGAAGAGGATTCGATACTTT
AATTCCTCATCGTGAGGTACAACAATGCGAGCGGTATCCGCTACATCCGTGCGATAGCACAAAAGACCATTATCGATGGAATATCGATGTAGGCTGGCCC
GCAAGCGTGCCGATAATTGACTGTCCTAGACCTTGTATTCCTCCTCACTCCCAAGGGCATGAAACAATGCCACAAACTGAGAATCCCGTGGATATGCCAC
ACGAATTAACTCCTCAATAGGAGACGACAAAGTCGTGACATGAGCAAGCTCATAATCAGGTCTGCGAGAGAGGGCATATGCCAACACATTTTGTTTGCCT
GGCTTACACTTCACCTCGAAGTTATATTCCTCAAAGAAGGAAAGCCACCGAGCCATTCTCTGAGAGAGGTGAGGTGACTGTGTCACCGTGCGTAATGACG
CATGATCCGTATAGGACGAATGGCTTGGAGCCAAGCAGATGGACTCTAAATTTGACGAGCGCATACTTCATAGCAAGTAGCTCTTTGTCATGAACTGGAT
AGTTCTTTTCAGCAGCTTTCAGCTGACGAGACTCAAATACGATAACTCACTCGCGGACTGCAGTATCTGTTTGTAGCAGGGCGCTGCCTACAGCAAAATC
GGATGCATCGCAGACAACACTAAAAGGGTACTCAGGATTTGGTGACACCAAAATGGAAGCATGGAGGAAACTCTCCTTTATTTCCCGAAATGCGTCAGCA
TGGGTGTTGTCCCAACGTCAATCTGTGTCCTTCTTAAAGAGATCAGTTAATGGCCAATCCATATCGGCGTAATTTTCACTGTGATTTTGTAAGTAATTGG
CAAGGCCAAGCCACTTACGCAAGTTTTTTTGATTCTTGAAATCGGCCAGTTCACTATAGCCTTGACCTTAGCGGGATCCGCTCTAAGGCCGCGCTTACCA
ATGAAACATCCTAGAAAAGGAATCTCCTCTACACCAAAATGCATTTCGACGCGTTGGCGTACAATTTATTAGTGCGCATGCACTCGAGCACGGCTTGCAA
ATGACCGATGTGATTTTCAACATCTGACCGACATTTTTCGTCCCAACTATGGACCAAAATGTCATCAAAGTACGTCTGTGCGTAATCGCGATGTGGGCGA
AAAAGTTGCGTCACCAGACGATTAAATGTTGCCGGAGCATTAGACAGCCCTTGGGGCATCACCAGCCATTCCCATAGCATACCACTGGGGGTGCTCACTG
CTGTAAGCGGAATATCACTCGCTCGCATGATTAATTGATAATATACATCAACCAAGTCGAGTGCGCTATACATAGTACAACCAACCATGTTTTTTTTAAT
AACATCCTTCCGAGGAATGAGTGTCTGTGCCGGAATAGTAGCCGCATTAAGCTTGTTATAAGCATGCACAATACGCCACTTCCCGTTCGGCTTTTTGACA
CAAATGTCGGTGTCGAATATGGAGATTTACTCTCACGAACAATTCCTGCCTCGTGCTTATCACGGAAGAAATCATCAATGACATCACATTGCTCCTTAGG
CAAGGGCCACTGTCGTGTGACACAATATTTAGTCCCAGGAACTAAGTCAATTTCATGACGGACACCTCTATCTGGAGGTA