Description :
From Genome Similarity Track
Location :
Scaffold_12:38785- 42679
Sequence
3894 bases(100 bases per row)
CACGATCACGACCCTCGTGATCGTGCTGCATCAACGCACATCCGATTGCGAAGTTGGATGCGTCACACACAACGTGGAATGGGCGATCTTGGTCGGCCAC
CGCCAAGATCGGCGCCTCAGTCAAGCCCCGCTTGACTGCATCGAAGGCCTGCTGACACTCAGCAGTCCAAACCCACTCGGCGTCCTTCTTCAGGAGCTGT
GACAGCGGGCGTATCATGCCCGCGTAGTCCTTCACGTACTTGCACAAGTACGTGGCCAAGCCAAGGAACTGCCGCAGTTCCTTGACGTTCGACGGCGTTG
GCCACTCATTGATCACTCTGACCTCCTCAGGGTCAGGGCGGACACCGTTCTTCCCAACGAGACACCCGAGCACGGGTATCTCGCTCGCCTCGAAGATGCA
CTTCTTCAGGTTCGCGTAGAGCTTCTGCTTGCGCATGAGCGCAAGCAGCTTCCGGGGATGCACCTTGCACATCTCAACATCGCTTATCCCGTCCGCAGCC
CGGCTGTGGACGAACACATCGTCGAAGTAGCTCGGTACGAAGTCGCGCACCGAGCGCAACAAGTGCGTCACGAACCTGTTGAAGGTCGCAGGGGCGCTCT
TGCGCCGGTATCGTCGCATCGTTCAGCTTGTTGTACGGATGAACGATGCGCCAGCCGCCCAGTGGCTTCTTGACACAGAACGTCGGAGCACTGTGCGGGG
ATTTCGATTCCGTACTTGTCCAGCTTTGCGACGACTCTCAAAGAAGTCGTCGATCGCCTCGACCTGCTCTCGCGGCAGTGGCCACTGCCGCGTGACACAG
TACTTCGTGCCCGGCACGAGATCAATCTCGTGCTGGATTCCCTTGTCCTGCGGAAGCTCCGCAGGAATCTCTTCCGGAAGTACGTCCGCGTACTCCCGTA
AGATCTCGTAGTAGGGACTCGTCTTCAACGAGTCCCAGCTCTGCTCTTCAAAGCGCTCCTTCTTCGTCTTCGCACTGAGAGTGTCCTCGCTCTCAGTGGT
GGTCTCCATGAAGAACTGCCTCAGTTCTTCATTCTCGCTCTTCGTTCTCTCGGCGTCCGAGAGAATGCATATTTGCTCGATGCATCCATCGTGCAAGTCA
CGCGCGAAGCGCTTCCAGTTCATTACTGGAAGCGAAGTCAACTCCGACGCTTGCGTCGGAGGGTTAGCGAGAGTCATCTCCCTGTACCGGAACCCGGCAC
AGATACGCGTCAAGACGTTCAACGTCTCGACGTCCGGCTTCTCAGCCTCCGTCTGCCCGGCAGACATTCCTTGTAGCGTCTCGGCCCCAGACCGAGACTT
GCGCAGCGACCATCGCATGCGCCGTCTTCTTGTTTTGGGGAGCCCGGCTCCGCTTGGTTCTTGACCTCGCCCAGGCCCAGCCGTGGACGGGTGTTCTTCT
TCAGTACCACCGGCGGGTTTATCCCGCGGGCGAGCGACTTCAAGCCCGGCTTTGTCGCCCGGCGCTTCGTCGTGCACGACAGCATGCAAGTTTTTTTCCG
GTGCGGGACGTTTGCAACCGTCCGCACCGCTTGCAGCGTCGACTCCCGGAGTCGACACGCCATCCTTACCTCGACGCCAACCATTGGCGGAGACCCCCAT
TACAGAGGGTGCGTCGGCTCCCGGAGCCGACGAATCAAATTCACCTAAGCCATCGACTCCCGGAGTCGACGGCGCCTCGTCACCTTGGCTCTTATTCTTG
GCCAAAACGGATCCAATCAGATTCGCGTCAGCCTCCACGGCTGAGGCGTGTGACTCGCCTGCGTCATCCGTGCCCCTTGAGGCCGGAGACTCTTCCTGAT
TCGCTGAAAAGCGGGTGTCGACCTCCGAGATCAACACATTTCCTTCATTAGCTGTCGGCGGCAACGCCGACGCTAGCTGCTCTTGCGCGCGTGCTCGCGC
GCGCCCAGGGCGCTCCGGGACAGCGGCATTAGGCGCTGTCTCGAGTGGGGAGTCGCGCGCACCTGTCGGTGCGTGCGTAGCGGCAACAGGGCCATCGCTC
ACTGTTCCGCTGTCGCGACCGAAGCGCACGAGAGTGCGCTTCTCCCAATCGATGACCGGATCATGCCGTGCAAGCCGCGGCATGCCTAATACGATGTCAA
ACTTATCGTCCAGATCCAGGACGATAAAGGTCTCGACAAACTCTTGGTCTTCATACGTGAAGCGCACGCGTACCATGCGCTTCTGGGTCTTCACGACGGC
ACCCGTTGCCAGTCGTACCTCCAACATACTTCGAGGTATCTTTAGATCCTCGAAGTCAAGCCTCGATAGACTTCGCAGTCGAACAAAGTTCTTCGACGCG
CCAGAATCTACCAAAGCGCGAAGAGAGCTGCTTGCTCTCATCGAGTTTACGTTCAGGATGACAAGGTCTTGCTTGTCATCTTGGTTCTTGCACCGAGAAT
GAATCTCACTGGGGATTGCAGTCCTCAGTGTCGCGTGTCCAAGGTCGACACGCGGAACTGCATTACCAGTAGGGCGCCCCGCGCCTACTGGCGTCCAGCG
TTTTTTGTTTGGTTGCGACGGTGCCCGGCACCGGCGCGATAGCCACCCTGCTGGTGCACGGGGGCCGTGCACTCCCGAGCACCGAGAGGTCCATGGGTTC
GGGGCCTCCCGTCCTCACTACCGGGCGTGGCTGTGGCCTCGGCACATGTGCAGGCAGCTTAGCCTGCCGCAGGCTAAACTCCTCCTGCATTGCAAGAGTG
ATTGCAGCTTCGAGAGTACTCGGGTACTCACGGAAGAGATTGGTCTTCACAGGCCAATCTCTCAGTCCCTTCATGAACGTGACGACCTTGGTCGCCTCGT
CGATCGGATTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTCTGAGCGTAAGCATGGACATCATGCTTGCCCTGCTGCAGGTCGAGGAACTCCGCCCT
CGACCGGAACTCGTTTTGCGGGGGCTCAAATGCTTGTCTGAGCTCTTCCGTGAAACCCTCGTACGTGCTAAAGCACGTAGGATCCGAGAGTCGGCGTCCA
TACGCCCAACTTCTTGCACGTCCGCCAAGACATGAAATGGCGAACGCGACCTTCGACAACGGGTCGACGATACGTCGATACGTCGAGCCGCAATGGCAGT
GTCGAGTTCGACAAGCCAACGGAGGAGGGGTTCACCCTCTCTTCCGACATAGTTACTCACATTGAGCTTCAGCGATTGCGCGCGTGATGTCGTCCCGGAC
GGCACCGCGGTAGTAGCAGCAACATCGCGTTGCTCCTTCAGGATGAAGCCCAGAGCAACACCGTGTTGCTCTGTCGGCGTTAGCGTACGCAGCATCGTAG
CTACAGCCGCCTCACCAATGACTGTTGACAGTCGTTGGAGAGCCTCCCACTCTGGATCCGACAGGTGGGGACAGTCAGCGCGTGCAACGTGAGTTGCAGG
CATAGTGGAGCTTTCCATGGGCACCTCTGTATCCATGGGAAGGTTCTCAGCTCCGCGTTCGTGCGGTGACGTACGAACTCAGGTAGTCGGTCGTTGGACG
GACTACAAAGTGCTACCAGGTGTAATGGGCCTACTTTGGCCCACTACTTTAGCTTACACGTGTGCGCGTGTATGTGAGGAAGCGTAGCCTAGTTTAAATT
AGAGTTAATTATACTCGGGCCTCCGAGTATAGATTAATCTAAATAAACGATCCAAATAATATTTTTGGGTTAAAATGAGAACTGCTATTTTTGTTTTATG
TTTCTGACTTCCTCTAAATGTAATATTCTAAGATAGGAATCTACCAACGGCTGGTTAGCAGGATTCCAATGCTATGCATGTCGCTCATTGGCTAAGAGAT
GCTGCTCTCAGCCAATAGGAATCCAAAGTCTCTATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGTCTTTGGTCTGTCTACACCAAGGT