Description :
From Genome Similarity Track
Location :
Scaffold_85:38783- 41083
Transcript NameFunction/comments
Physo_140382hypothetical protein

Sequence
2300 bases(100 bases per row)
CCGATTTCGAGGCTGCAAGCGCCCATCGGCGCGGAGCCCAGCGAGCTGGCGACGACTATCCATAGACGCTGATGGCGGCGGACATGTACTTGGGCCCCAA
GTCTTCGGGCGAGGCTCGGTCTGCAAAAAATATATTCTCCCAGCGATATGGCTCCATGCCCAGCGCGACGTGTCAACCGCCGATTACTTGAAATTTGTAT
GTCCTGCGCTAAAGCAGTAGATTTGCGACCACGCTTGCAAAATGTAACGTTGGCCCGCCTAAAAGTCGATCACCGACATACAGTGTGGATGCCCATGAGA
TTCGCGGGCATCCACACTGTATGTCGGTGATCGCTTTCGTGGCACGAAAGCGAAACTATATTAGCACGCGCCGCCTACCTAAAACGGCACTTTTCCATGC
AATCCCAAAATTGGGTTCTTTGAACGGCAGATTCCGAGGCTGCATTTTGGTACCAATCGATACCTATCGGTCTTGTGCGTGTAGTGATAGTGGTCTCAAC
TTCCAACGCGTGGTAGTCGCGATGAAACAGCTTCGTGAAACCTTACATTTCAGCACCGAATCGCGGTAAGTTTCTGCCATTTTTGTACTGCAAGTAATTA
ATCGCTAGACGTTAGTATAGCTGTTGGTAATAAGGTCGCCTTGCAATTATTCCAAGTCGTAAGCAAAGGTCTATTAGGCCTTTGTATGGGGATGAAAACT
TGACCGCGTATTGAACGCGAGTGTCAAGCGCTATAAAGCTAAAAATAGCTTATTACCTATTTCTTATACATAACTGTGTAGGTGCCAGATTTCAAGTTCA
TCGGCCCATTATTGCGAAGAACGAATGTATCGATTGCACGAAAAAAACAAATGTTCCCTGTTGGAGTCGACGCCTGTAAAATCCACAACTATGATCGCTG
AAAGTGCCCCCCAACGGTTTCGCACCAAGCCCTTGCTTACATTTCAACGCTGTGAGCGATACCACAAAGCCAACTTAGTTGAGCGCCCACCCGCCGTTCG
CTCAGCTGCTGTACGAAGCCACTGGGAAGCCAGCGAGCGAACCATGCATGCATCTACAAGCGCATTCGTCGCTTGATCGCTGCGGGCACCAATGAATGGC
CTCCGCCACTGCCCGACGTTAACGTGGCGTCGACTATCACATCGTCGTCGACGTCCGTCGCGGCGAAAACGTACTGAGAGTTCTCCTATCTACTGACGTA
GGATACAATATGTCGGTACATTTAACATGCCCGTCTCTTGCCCGAGCAATCTGATGGCCTAGCCCTCGCCATATGTCTTGTCAGGAGGGGCTCGCTCTCT
CCGCGCGCCTTCAGTTCCTAGCGGCGGCCCACCACGCAGCGCAGGCAGGCAGGGCATCGATCGGCATGCCTCGCCCCGAGTACGCGCCCTTCATCACGTC
CCCGCGCGGCGCGTCCGGGCCCTCGGTCGTGGGCTCGGCGCCCTCGGCCGTCTCGGCCCTGAGCGCCGCCGCCTCCGAGACCCTCAGCGCCGCGCTCAGC
GTCGCCAAGCTCAACCTGCACCGACGCCGCCGGCAGACGCTCACGGACCCGAATGCGCGCGGCCGCAGCGCCGGCACGCGCAGCGGAGGAGGCCACACGG
GCCGGCGCACGCCCTACCTGGACCGGGAGGACGAGGAGGAGGACGACCCGTACGACCCCCCGCAGCAGCACCACTACCAGCACCAGCGCCAGCGCCAGCA
GTACGACCACGAGCCGCAGCAGCGCTACCGCGGCCGCCAGAAGTCCGCGCGCTCGGCCTCCAGGTCCCCGGCGCCCTCGCCCTCGCGCGGCTCCGGGGGC
GGCTTCGCCTCCATGCTCTTGTCCTCGTCCTCCTCGACGCGCTCGCTGTCGCTGCGCTCGCCGTCCGCGCGCTCGTCGTCGGCCACGTCGCCGTCGAGTC
TGCGCGACGAGAGCATGTCGTCCATGACCAGCGACATGGCGCAGCACCTGCCCGAGCTCTCGGCCGACCGCGTGGAGGCGCTCGTCAACTTCATCGACAA
GTCCGTAGACGACGCGTACAACCTGAGTCTGGGCTTCGGCCGCGTGCGCTGGACGCCCAGCCGCGCGCGCGAGGGCGTGACCATCCACCGCGCCAGGAGC
GGCCCCGACGACGCCATGCTGGACGCCGCCGTGCGCGGGAGCTGCAACATCAGCGCCACGTTCCGGGAGATCAGCGACCTGCTCATCACCGAGACCAGCG
CCGACTTCGCCGAGCACGAGAGCGCCGTCAACCCGAGCGAGTTCCTGGACGGACAGGTGCTGTACACGCTGGTGCCGCGCACGCCCGAGGAGCGCTTCGT