Description :
From Genome Similarity Track
Location :
contig_42:38779- 39809
Transcript NameFunction/comments
g7684.t1hypothetical protein

Sequence
1030 bases(100 bases per row)
GTTACGCGACTCCCGCATCTTCGTCACGCACAGTACGCAGAACTTCGTCTTGACGATCGCAAAAGTCCGGTTTGCCCCAACGCGCTACCCGTCTCGTCCT
CCTTGGGTGCGTCACGTACAATAGCGCATCGTCGGCAAATGAGGTCTCCGCACAGTCTGCAGTGGTGGCGACGTCGAGTCGGCCCGAACTTGCGCGAGCA
CACGCTGCAGCTCTTGCGAGAGCCCGACTTGGCCCAGCTGTCCCGTTTCACGACGCCCTGCATCAAAATCCGTCGCGAGTCCACGAAGACCGCCATGTTC
ATAAGAATGTTCATCATGCGCTTGTAGTAGTTGGCGGTCACCGCGAGTCCGTTGAAGTTGTTTTGCGACAGCATGAAGAATTCGGTCACGTTCGGCTCGC
GGTCGGCAGGTCGAGAGATCCAGATCGTGTTGAGCCGAATGCGCTTGGTTTTGAGCTTTTTAGGCAGGTCGGGGCACTCCGGGATATCAAGCGGCAGCGT
GACGCGTACACCCACGTCGCGTCCGCGTAGGTCCTTCGTGTAGATGAGGTACTCCATGTAGCAGTTGTCGCGCTTCTTCACGAGCGGCGACGGGCTCAAA
CAGGTCCATTTGATGCCCATATACAAACACTTTTTCTTGGACGCCACCGTGTGGATGTTCTTGAGCACGGCCGCGTCTGTAGCGTAGCCAAACATGAACT
GGTTCCACGCGAAGAGCTCGCCGACGTCTCGGCATAGAAGAAGTCGATGAAGTGGCGGTAGTCGCCGTTGATGCGGCCGAAGATGCGCGCCTGGCTCGCC
GTGGGGCTGTCGGGCGTCTCCTTCTTGATGGTAGTGAGACCTTCCACTTTACTGACGGCAGTCCACGGCGCGCGGTAGACCGGGTTCAAGCCTTTGGCCT
CGTGCAGCTCGTACTCGGCCAGCGCGTTCTTAACGATCTCCTGCATCTGCTTCTCGTAGTTCTTGGTCTCCTTGGACGTCAAGTGGATCTCCGGGAAATA
GTCGTCCGGCAAAGGGAACTGGCCGCCGTT