Description :
From Genome Similarity Track
Location :
contig_46:387788- 388826
Transcript NameFunction/comments
g8227.t1hypothetical protein

Sequence
1038 bases(100 bases per row)
ATCGGCTGCCGATCTCAGACTGAGACGGCATCCACGGCTCGCGCACTGGCTCAGTGCGAGGCCGCAACAACAGCGGATGGAGCAGAGTCATCTCCATCCC
GCGGAGTCGTCAAGGCTCCAGCGGCAGCGAGCGGTGTTCCACTGCCGCTGCGCGAACGCTTCGAGCTCGAAGCGTTCGAGTCGTCCTCGCGTGGACGACG
CAGACCCACATTGGGGTCAGTGTGGCCCGGAGACAAGTGTCCTTGTCTCCTTCGAGTTCCCCCTCCTCGACTTCGCTTCCGTAGTCGAGGGGAACTCCCT
CTCCACCCGGAGAGTAGATGCCCACTCCGGTTTCGACAGCAATGATCTTGCCTGTCTTGTTTCGGATGGCATGTTTCTCATGCCATCTCGAGTGGTATCC
AGCAACAGAGAGGCGACTCTCTGTTGCCGCGCTTGTCGCATCGCCGTCGAGGCGATCAGTAGCGGTCGTGGCTGAGGCAGCGGCCGTCGTCGCCTTGGAG
GCGACGACAGCACTTGCTGTTGCCGAAGCGGCCGGCGTCTTGGACGAAGACGTCGTTGGCGTGCTCATTGGGAATGAGCACGTGTTCTCCCGAAGAAAAT
ACGGATTGACGTGTCGAGACCGGCACGTCAAATCCTAACGGGGGGATGGTGTAGCGGGGCTACACAGTCGGTTCACCTCCTACCTTAGTGCAACATGCAC
TAAGGAATACATTCAGGTGACCACTCCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCATGAGAGTCAT
TCAATAGATGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATT
TGGCACCAAAGCTATCGTTCGGTTCCTTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACTTAAGTAAATTACTCCTACGCTTCCTCATA
CACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAA