Description :
From Genome Similarity Track
Location :
Scaffold_227:38763- 40063
Sequence
1300 bases(100 bases per row)
GGAAGTTCGGACAAGCAAGCACAGATGACAAGCGGCGCTTCTTTGATGGCTCACTATCCAATACTTCTTCTTCGTAGCTATTTTCACAGAATGTGAATAA
TCGTTTCGAACGAAGAGTGGAGTAACAGAGCCAAACCGTTGCACGATACTTTCCGTGTCAATACACGGAAAAGTCTGAGAAAGGTTCTAAGTGCGGTACA
CACTTAGACCATTTATGTGGTTGAGGTACGGCAATAGCGTCCCTACCACAAAGTGTGTCACACACACGGATGACGTCACTATTTGATTTCATTAGATGAT
GTCATTAGATTACGTTAGCAAGACGCTTAGATAAGTTCAAGTGCTTTGTAGAGACCGCGTCTTATCGGAGCGCGCGTCCAATCTTTTGTCTTTTACACAA
TAGCCATTTATATTTCTGTTTAACTGATTGAATAGTAATAAGTCTTACATTTGCAACCTACTTGTGATGTGTGTGCCGGAGGACAGAAATCGTGTCCAAG
CCACAACAATCGTTCATCTATCGTTGAGGTGCCCACTCAAACCTCGCTGCGCGCGAGAGAAGAAGGTAAAACCGCTTACTCGCAGGTGCCTGAAGGTGTG
CGTAGAGGTAGTGTGTGGCAGCTTTCAGCGCTCGCTTCCATAAAATGCTTATACATTATCTTGGACATCTAGATTTCCCACACACGTGGCTTAATGAATA
TTGGCGCATGGTGCGACGACTAGCAATGTAAGGCACTGCGGATTAGTTTAGCTTCGTTGTCTCACGCCTTCCACATACGACTAGATGTTTTAGTGTCTCT
AGGGCAAGACTAATGAGGTATAATTGATCCACGGCCATGATTGTTCCTTTTTCGAGTGAGCTGATTAGCGCTTGTCATCGTTATACAAGGGCGATGAGAA
TTTGGCACTAACAATGACCCTAGTACAGCATATTCATAGCGATCATAGCATAGTTAAATGTAGGGCGCTTTTCCGAAATCGATAACTATAATGACGTTTA
CGTCGAAAGTACCGCGCTGTGATGAGCTCGAAAAGCAGCTACAGCGCGCCGCAGAAAACATTCAATTTTGTCGTTGGCTTTGAGATTGGCGGATCGACGG
TGGGGGGGGGGGTCAACGAGCAACTTCGTCACTTACACGATGTGGTAAGTATATTAATCTGACAGAGTGAGTGCTCACAAGATTATTTTTATGTAAGCGG
GCACTGTACTAGCTGCCACGCACTACAAGAGCATACACCTTAAGAGCAATGAGGAAGTGGTTATACCGTCTTACTTCGCGTGCTCGTGGTGGTGGGGTCG