Description :
From Genome Similarity Track
Location :
Scaffold_9:387584- 392900
Sequence
5316 bases(100 bases per row)
CCCGTTACACCTGGTAGCACTTTGTAGTCCTTCCAAGGACCACAAAACCCGCTCAACGTGAACACGTTGGACGACGAAGGCGATGACACCTTTCACGGCA
CCCGTGAAAGCTACTTCTGTTTGAGTGATGTCGAATGGAGTGCGGTCGAACGAATGAGTGCAACCGTTGGTGAAGAAGCTGTCTGGTCTCTGCTATCCTC
AAGGGATATGGACCAACAGCATTCCATAATCGCCAAGTTCTTGCAGCGAGAACTTGACGCGTCGTGAGCTGAAGTGACCTTGCTGCATCAGCACGGTCAC
CAGCAGACTGATCTCCTGAGACAGCAACAGTCTCATTCTGCTACTGCAGCGTCGACAAGTGAGCGCCGACGCGAGACTCTAAAGTTAGAAGTCTCCAAGT
ACCGGGGAGTCGAGGAAGACTCCCTGTTGAGATGGTTCCTCGAAGTGAACGATGACATTAAGGCTTGCCACATTGACGATGAGGAAATGCAAGTTGCATT
TGCCAAATCAAATTTATCAGGGCGTGTCAGAACTTGGGCCCTGAATCTTCAATTATACGATCCAAACGTGTTTGAATCGTTGGCAATCTTTAAGATTCTT
CTCAGCCAAACTTTTGAGCCACCAAGAGCTGAGTTCAGAACGCTTTCAGAGCTCCTGAAGATAAAACAAGGTAAGCGTGACGTTCACGCTCAGCACGTTC
GTTACCTTGCAAGTTGCATGGTAGCGAACCATGTAAGTGAATTTGTGTTGATCTGATATTCTTACAGGGCATCATAGATGGTCCCGTGAGGAACAACCTA
TTCCGCATCGAGTTGAAGTCTCTTGAGGTAGCGATCACAACTGCGGTGCAAGAGGACTTTAGTGTGAGACAGGCTCACACTAGCTTGACCCCATATCGTC
CTTCGAGAAGAGTAGAGACGGGAGGTCCAGAACCAATGGACCTCTGCATTGTTGAGAGTGAGAGACCTCGCTCTTCAAGCAGTAAGCAATTGCAAAAGTG
CAATCGCTGTCAGAAGTTAGGACACTACGCCTACGAGTGCAGTGCTTCGCGCCCAGTGTATCGTAACAGTGAGCGAAGTGATCGACCGTCTGCCAAGAAG
GGCAACGGACGCGGATCCGACGCTGTTGCGAAGTCACAACAGCGTAGCGGACCGTCAAAAAACAGCCGGGGTCAGTAGGGGCGGAGCGCCCTACTGATCC
AGCAACCTCAATAGTATTTGAAAATCTATTGATATAAGTTGCTCCAGACTCACAATACTTGTGTGGATCTGCACTTGGTGATGAGGTACCCCTCATCACC
TTGAATTTAAAAGGGACAAAAGATTTGTCACTTCGTGCCTTAGTTGACTGTGGGGCTTCGAACAACTTTGTTCGTCGCCAGTCGCTAGAGGATCGTAGGC
TCAAGTCATTGAGAGCGTTACTCCTCCTACGAGGCTGACAGTGCGCCTCGCAACAGGCGCATCGATAGCAGTAATGAAACTTGTAGTGGGATTTCACTAC
ACGTTAGAAGATTTGCAGTACAATGATGATTTTATCGTACTTGATTTGCATGACAAATTTGATGTCATGCTAGGGTTACCCTGGCTCAGAAGGTACGAGC
CAAGGTTCAGCTGGTAGCATCGAACCGTGAAGATGCCTGCCACTTGTTCATCAGATGGTCATCTGATGAACATTTGGATCTTCCACAAGCGTGTGGATGT
ACTGCGAGAGTGCGATGGCCTCACTTGCGGTACGGTCGTTAGCACGACTGCACAAGATCACAGTGTGACAACCAATCACACTGTGGAGGAAGCTGCCGGC
GGCTGTGCGGATACACAGGCAGCGCCGAAGGTCCACCACTCAAACAAGTCGAGTGGATCGGGACATGGGTGTACGCCTAGCGGGCAGCATCCAAGTAAGA
ATCAACCAGTTGCCCACACAGGGAAACACGGTGTTCCTACATCGACTGGAAAGCCGATTGTAGAGGACATAGCTGTGGTAGCGCAACCACAGCTAGAAGG
TGTCAAGGGAATAAGTACCCAGCAGCCTGTGGAAAAGGGTTCCCAGGAAGAAACCGAGACATTAAATGTATTAGTTAATGACGGGTCAAGTGTAGGCGCT
TATACAATTGATCTGATCGCACCTCCGAAGTCGACTTCGGACATCACCCAACTGCCAGCACTAGAACTGAAACGGTTCTTGCGAGATCTGCGTAGTGACA
AGATCAAGCCCATCTGTGTACTCTTCACGGAGGACGAGTACGTGACTGACATTCGGTCGGCAGTATTATTTGCAGAGAACGAACGGGTTCTCAGCAGCTC
ATCAATGGACGAAAGTGTCCTCGATGAGAAGACTTGGTGAGGGATACACGTCTCAATCTTGGGAGTCGCTTCAGGCAAATCCTTTGTATAAAGATTTGAT
CGAATTCAACGACGTGTTACCTGAATCCGTACCATGCAAATTGCCTAAAGATAAAGGCATTCGACATAAAATCGAGCTCAAACCGGGCTCGAAGTACTGT
GTCATGAACCAGTGGCCACTGCCTCATGAACCAGTACTTGCGATCGACAAGTTCTTTGCCGATCGCTTAGCTGCGGGTCAAGTGAGGGAGTCGACTTCCC
CTCACAGCTCTCCTACCTTCTGTGTGCGCAAGGCCAAATGGCGTATAGTGCACGCATTAAACAAGTTGAATGCTGCAATGGTACCGGCTCAGACGCCGAT
ACCGAGGAAGGACGTAATCATTGATGGTATGTCAAAGAGTACCATCTTGTCGTCCATGGATCTGACGGATGGCTTCTATCAGATCCTAATGCGTGAACGG
GACATCCCGTACACGGCAGTAAACACCCCGAGCGTCATGTGATCTGGGAGTGGCTAGTAACGCCACAAGGGCTTAGTAACGCCCCTGCCACCCTGTGTTA
CAAATCTGTTGAGACCGGTGTGAGACTTCGCACCTAGTTACTTCGACGATATATTCGTCCATAGCCGGGCTATGGGCGGAAAGACGGACGTAGAGGTTAA
TAGAACACACGTTCGTCAGGTTCTTATACTTATGCGCAAGCATAAGATGTATTCCAACCTGAAGAAGTGTATATTCGCTGCTAGCGAAATAACACTTCTT
GGGTGCATCGTGGGTAAAACGGCGTAAGCCCTGATCCTGAAAAGATCAAAGCAATTACCGTCAGACCTGTGCCAGCCGACGTTAAGGGACTAAGAAAATT
TCTCGGTCTAGCGGCGTACTTACACAAGTACTCGTGCAACTACGCTGAGATGACCGTTCATCTCTCTCGTCTCTTGAAAAAGAACGAGAAATGGTCATGG
AACGCTGATTGTTAGCGTTCCTTTGAAGGTATCAAGCAGAGCTTGATGCAATCGTCCATCTTGGCGATTGCAGACCATGACAGACTATTCCATGTGGTCT
GTGACGCCAGCGATTTCGCAATCGGCTGCACGTTAATGCAGTACGATGCAGACGGCGCAGAGCGTGTCGTCTGTTATCAATCGCGTCAGCTGTAAGCAGT
TGAGCGTAACTATCCAGTGTATGACAAGAAACCCCTTGACATGAAGTATGCACTAGCGAAGTTCCGCGTCTATCTCCTTAGAGATAGGCCGTTTGTAGTC
AATACGGACCATGCGTCATTACGCACGGCCGTAAACAGCCTAAACCTCTCGCAAAGAATGAACAGATGGCTGTCCTTCTTTGCGGAGTACAACTTCTCCG
TGGAATACAAACCTGGACGACTCAATGTCGTCGCAGACGCGTTGTCGCTCCGACCCGATTTCGAGCCGGCTGCGAAGTCCAATAGTGAGGTTGATACCAC
TGTTGCAACACTAGTCACTACTGTTCCGTCGCCAACGTTGCTTGACGACATAAAAAGGGCCTACGCAGAAGATGAGGCTCATCTGCGACTGATGGATCAT
CTGGTGAATCTATACACCGTTACCGGCGCCGCACCTCGTGTCGTTGTCCCCACTCATAATAATTTGCTCTTACGCATCATGTATAAGTGTCACGATGCAC
CAACTAGTGGCCATCGTGGGCGTGAGAAGACTTATCTCACGGTAAGTCGCGACTTTTACTGGACCCGCCAGTATCAGTTTTTGCGCAAGTACATTCGTGT
TTGTGAAGTGTGCCAACGGGTGAAGTCCAGTCCTTCATCACGCGCGCCACTACAGCCTCTACCAATCCCGGCAGAGTGCTGGCAGTCCGTTTCAATGGAC
TTCGTCGTCGGAAACTGAAGACGCTCACAAGAATAATGGTATTCTTGTGTTTTTAGACCAATTCAGCAAGATGGTACATCGTGCTGCAGTTAATGAGTCA
ATCTCAGCACATGGTTGTGCCCGTGTCTTCATTGACACGGTGTTCCGACTCCACGATATACCCCGTGAACTAGTCTCTGATAGAGAGCCTCGGTTCACGG
CGACGTTTTGACAATTCGTGTTCCGATCCCTCGGAACACGTCTGACTATGTTTACTTCTGACCATCCCGAGACTGATGGTCAGACAGAACGCGTCAACCG
CGTCCTCGAAGAGATACTTCGAGGATACGTCCAATCCTTCACAGATTGGAGCAAATTTTTCCCGATGGTGGAGTTTGCAATCAACAACTCCGTACATGCA
TCGACAACGCATACACCAATTTTGTGAATGGCTTACGCCATCCACGCCTACCCACCCATTTAGAGTGTGACACTAATTCAAGGGGGGAGAGGGATTCGCT
CGAGCAAAATCCGTTCTGGCTCTTGCTCATCACGTGTCGAGGTAATCGACGACGCGAACGTTGCCTATTCGATCAAGTCGACATAGAAGAAGATAAACTT
ATCACTAGTGATGACACTATTGCTGACTCAGATGAGGATGACGATGCTGGTATATTTAGCATCTATAATGACTACACTAGCAAGGATGAGAACACTCTCG
CTGAAAAAGATGATGACCTCCTAGTGGTTCGCACAAGGTGCACTGCAACAAACCAAAGTGATGCAGCAGAAGATTTCCTGCTATCACGAGAAGAAGTGGT
CCGTTTTTGTGCAAGACTCCATCGCTAACGCGGTGGACCGGCAGAAACGGAATGCTGGCAAACATGGAAGAGCAAACGTTCTTCTATTTAATGCCGTAGA
CTTAGTTCTACTGTCTACGGTAAATCTGCCTAAGCACGTAGTAACTAATGTGGGTAGCAGTAAACTACTACCCAAGTAAATCAGCCCATTCCGTGTACTA
CATCGCAAAGGCAATGCGTACACAATCGAGTTGCCTCGCAGGATGCGTACGCACCCTACTTTTTATGTCGGTCGTCTCCGCCCTTACCATCACCACGAGG
TCTCTTCCTCGGACGA