Description :
From Genome Similarity Track
Location :
contig_68:38751- 40018
Transcript NameFunction/comments
g11348.t1hypothetical protein

Sequence
1267 bases(100 bases per row)
CCGCCGAGCAAACACACCAAGAAGGGGAGGAGCGAGGGACAAATTGGCACGCCGCAGAGAGCGCAACAAGCTGCATCAACGACGTTACAAGAAGAATCAG
CGCAATCAAATACAGAGCCTCGAAGACAGCATTGAGCAGTTGAAAGAAGAAACCCAAGAACTCGAATTGCAGCGCCAGCTCGTGGTCTTGGATGGCCAGC
GAAACAAGTCGATGTGGAATGTGGTGACCGAGTACTTTAGTCTATTTCGCTTTGGTGTCCAGGTACATATGCCGGTGGCACTCGATAGGCAATGTCCGTA
TGATACAGAAGTACAGAGAACTTCCTACGCTCAACAATGGCGCAGGACGTGACCGCCGGCCAAGTGTGTGGCCCTGACGCAGTGCTGGAAAATTGGAGGA
AAATGTCGCTTTACCACTCTGGGATGAACATTGAGCTCGTGTGTTTGGAGAATGGTCCCGGGGACTCGTTGATCGCGACGATAAAGCAAATAGTTACTCT
GAACGAGAACATGATGCGTCTTGTGTTCCCGCACTTGATCAGTGATGAAGGTAGCGAGCACTCCCAACTGGCTTACAGACTTCTTGGGCAACAGTTTGTG
GTTCATGGTTCAGTGCGTTTCGAGTGGAATGAGGAGCTGAATCTCGTGAAGAGCTTTCAATGCAAGGCAGACATACTGACCCCGTTGCTGCGCGTGCTGG
GCAGTTTGGAAGATGTGTCTCGTGTGTTTGACAATGCACTGCTTACACCTGAGAGCGAATTAGTTGCTGGGCTGTGACTGCTGTCTGGGGCTTTGCTGTT
TTGGCACGTAGTCGTTTTTCTTCTAGCACGCAATGTTAGCGAGAGGTCGTAGTTTGTCGGCCATCTACTACGTAGTAGCTACTAGTATTTGTACTGGCGA
GATGAACTAATACACCAACGTTTTTTTCTCTCGATAACATCGCTAATACTTCGAAGTAATAGTTAACTGCTCAAACCTCGTAAGATCGCGGAAATAAAGG
GCAACGCTTGTAGCATGCCGTTATGCCGATTTCAACTGCAGCAACAAAACAATTTCGTGCTTACTGTGTTTCTCCCCGATTATATCTTTGACGCGAATGC
ACGAATATGAAAAACTCAGCGCGACAATAAAGTGGAGCACTTGCTACCCCATTTAAGCTCGTCCTCAGCTTGCTTTGCTTTTATCGAGGATTGGCGCTTC
CGAGCATGTAAGCACTCATCAAAGAATTGAAAGGATCATATTGAAATTTGTTTTCATTCTCTCATCC