Description :
From Genome Similarity Track
Location :
Scaffold_2038:3875- 5471
Transcript NameFunction/comments
Phyta_totarag14033hypothetical protein

Sequence
1596 bases(100 bases per row)
GACGAGGACCGGATCCACTACCATGAGGGTGGTGAGCTGATGGCAGAAGACATCGAAGGCGAGTTGGCAGTGCTTCCGGAGGTTCTCATTTTCACGACAG
ACGAGGTGACGATCGAAGATATCAAGGTAGGCGATCTGGAGTTCAATACCCCGGAGGAGATCGATCGACTACGAAAGAGGATCTGGCGGAGAAGACACCT
CTTGATCGGCAAGGGCAATGCACTGCCGCCGGCAGCCCGAGGTGTTATGTGCGACATCAATGTAGGCGATGCAAGGCCGATCGCATAGCGAGTGCGGAAA
GTGGCACCGCGATTCTGAGAGAAGGTGTCAGATCTGATCAAGGGTTTATTATCGGCCAAGATCATCAACCACTCGACGTCCCCATGGGCGTCACCGATCG
TGgtgatcatcaagaagaacggtgTGGATATACGATTATGTATTGACTATCGATTGGTCAACGGTCTAACTCGGCTGATGGTCTACCCGATGCCACTGAT
CAACGATCTACTCGAGGATCTGGACAAGGTATTGTGATACTGCTCTCTGGATATGGCGAGCGGGTTTTGAGTGGTGCCGATGACCGATCGAGCTCGTGTG
ATCTCGGCGGTCATTACTCCGTTCGGCCTGTTCGAGTTGAATCGAATGCCATTCGGCCTCAAGAACGCACCCCAGATCTACCAACGGCTCCTGGATAACG
CACTGTATGGATTTATGCGGATCCCGCGATCAGAGAATTCTAAAGGTATCGTGGATCTGTTTGAGGATGGAAAACCGGAGGATCCAGGATGCTCATCGGT
GTTAGGACGCAGATCctacatcgacgacatcttAGTGACAGCCGGATCCTGGGATCAGCTATGCAATCGGGTGGAAGATCTACTGGAAGCGTGCGATAAG
TGGAATCTGTCGATCAGCGTGGCAAAGAGCTTCTGGGGGTTACGCAAGGTGGACTATCTAGGACATCGGGTGTCGAGGGAAGGTCTAGAGGCCAACCCCA
AGGATCTGTCGGTATTAACGGATCTGCCTTTCCCTGGATCACTCAGATCGATGCAGTCTTTTCTGGGCAGCTTAAATTATTACGGCCGCTTCATAGAAGA
CTACGCGATCTACGCGGCGATCCGATATGAGTTGCGGGAGGTGGACTTCGCCGAGATGAGAACACGTCCGGGTCTGCGTCAGATTTTGGGGAAGCTAGAT
CAGGAGCCACCCGATCCAGCATCGTCAGAACTGGGGGCGCTGGATCCAGACCAACCAGACCTCGACGTCGCGGACGGGCGATGATTCCGAGCTCACAAGG
CTTTCACaatgttgaagaagaaggttgcGACGACACCGACTCTGCGTCACTTCGATCCAGATCGACTACCAGGGGTGATCGTGTATGCCAGTGACTGGGC
GATCTCGGCTGCTCTGGTGCAAGAACACGATCGGATCTACTGTCCTGTCACCTTCGCCAGTCGGACGCTCAAATCGAACGAGTTGAACTACaatgtggtg
gagaaggaagtgctAGCGTTGCTGCGGATCCTAGATCTCAACTACAATATGTTAGTGGGGCGCCAGATCCGGATCCTTACTCGGCACTCAACTCTG