Description :
From Genome Similarity Track
Location :
contig_24:38746- 40736
Transcript NameFunction/comments
g5329.t1hypothetical protein

Sequence
1990 bases(100 bases per row)
CTTGACCAAGCTCGTGCACCTGCATGAGCCCGCGATTCTGCAGGTGCTGCGTCGTCGTTTCTTCCACGGAGAGATCTACACCAGCACAGGGCAGATTCTG
GTCGCCATGAACCCGTTCAGACGTCTGTCGCTGTATTCAGACGACATCAAGGACCGGTACTATAACCTGGGAGGAGACGCCGAGGCGGACAAGAGCATCC
TGGCGCCGCACGTGTATTCAGTGGCGGACCAGGCGTTTCGCACGATGCTCGTGCCGCAATCGAGCGACAAAAAGACGAACCAGACGATTCTCGTGAGTGG
CGAGAGTGGCGCCGGTAAGACGGAGACCACCAAGCTCATTATGAACTACTTGGCCTACGTGTCGACGAAGCGCACGCGCCGCCCGATTCGAGAAAGCAAC
TGTGACCAAACGACGATTCACGACCGAGTGCTTGAGTCCAACCCGATCCTAGAGGCGTTCGGAAATGCCAGGACGACGAGGAATAACAACTCCAGTCGCT
TCGGGAAATTCATTAAGCTGGGTTTCACGTCTTCAGGTGAGATGCTGGGCGCTTCTATCTCGACGTACCTGTTGGAGCGCGTGCGTCTTGTATCACAGGG
CAAGGGTGAACGTAACTATCATATTTTCTACGAAATGCTCGGTGGGAGCTCCCCATCGGAACGTCAAGAACTGGCGCTGCAGGACGTGCATGGCTACGCT
TATTTAAATCAGTCCGAGTGCTATGAGCGCCTGGACGGCGTGGATGATGCTGAGTCCTATCAGGTGACCCGGCGAGCCATGTCAAGTATCGGAATGAACC
CTGATGAACAGGTCAATGTGATGAAGATCGTGTCGGCCGTACTGCATTTGGGAAATGTAGTTTCACGACTGCCACGCGCAATGGCGGGAAGGATGATGCC
TCTGTCGTTGACATGGATGCATGCGGCGACAACATTAAAGCTATTTGCTTACTTCTCGGTGTAGAGGAAGACGTGCTACGGAGTACGTTATGTACGAAGC
AGATTAAGGCTGGTGCCGAGTCCATCACGACTCGTCTGCCAGTAGCGCAGGCACTTTCGACGCGAGACTCTGTGGTGAAGACTCTCTACTCAAACCTATT
TAACTGGCTTGTGGACCGCATCAACCGGAGCATCGAGTACAAGGAAGAAGCGGGCGGCAGTCAGTTTATTGGTGTCGTTGATATTTTCGGCTTCGAGATT
TTTGAGCAGAACCGTCTCGAGCAGTTGTGTATCAACTATGCCAACGAGAAACTGCAGCAGCTCTTTGGTAGGTTTGTGTTCCGTATGGAGCAGGACCAGT
ACGTTGCTGAAGAAATTCCCTGGAAATTTGTGGACTATCCGAACAATGACGTGTGTGTAGCCCTTGTGGAAAAACGACACATGGGCATCTTCTCTCTGTT
GGACGAACAATGCCTAATCCCGCGTGGTAACGATGAGAAGCTGGCTAACAAGTACTACGAATGTCTTGCCGGCAAGCACGAAAGTTTCTCCGTGACCAAA
CTCCAGCGTGCGAAGGGTCAGTTTGTGATTCACCACTATGCCGGCGATGTGTGCTACATGACTGATGGCTTTTGCGACAAGAACAAGGACCACATGCATA
CAGAAGCGGTGGATCTGCTTCGTACCTCCAAGTTTTCCTTCGTTCGTGCTTGCTTTGCAAACAGCGTCAATACGACCGGAAACGGCAGCCCCAGGAACGG
TCGGACTGAGTCACGTGGAAGTGACTCCACTCGACGACGCTCCGGGGGTATGTTGTCTTCAACGGTTGTAGCACAGTTCAAGAGCCAGCTAAGCTCATTA
CTGGATGTTTTGAATGGGACGGAGCCCCACTTTATTCGTTGCATCAAGCCAAACGACCAGGCGAGTGCGTCGCAGTTTGAACGGCGGCGTCTTCTTGAAC
AGCTTCGTTGCAGTGGTGTACTGGAAGCAGTCAAGATTTCACGCAGTGGCTATCCTGTGCGTTTCCCTCATGAGGTATTTATCAAAACGT