Description :
From Genome Similarity Track
Location :
Scaffold_14:38746- 54611
Transcript NameFunction/comments
Phymu_g1004conserved hypothetical protein
Phymu_g1005hypothetical protein PHYSODRAFT_469105
Phymu_g1006conserved hypothetical protein
Phymu_g1007pyruvate dehydrogenase [lipoamide]
Phymu_g1008hypothetical protein PHYSODRAFT_349437
Phymu_g1009hypothetical protein

Sequence
15865 bases(100 bases per row)
ttgaagttgaagtgcattCCGCATTGTGTAGCTGAACATGGCACGACGAGCACGTGACGAGAGTGGTGCGTCCCCCCTGCGCTACTTAAAGGCTAGTGCG
GCCTGCTAACAGCTTCGGCACCTTGCAGACACCGGTTTTGACGTGGAAGAACGGAGTTTGAAGCacatgaagttgttgcaAGACGGTCAGAATATCCAAG
TAGGTGCATCGAATAGTATCTATCTGACGTATGTGTTGCTTTATTCAAGCAGGAGAGGGCTATTATGGGGAGGAGTGGCGCTGGGGAACCTTTCTGAAGA
AGCTACACTTCTTCCTGGACCATGGGACCGCGGGATTTGCGCTCGCTTGGCTGCATGATGGCTCCCACTTTATCGTTCACCACTCAACGGAAGTTGGGCT
GACAAAGCAGTTGGGACTACGAGCCTGTACGCTTcaccaagtgctggagacACTGGGTTTCGAGTGCCAGGAGGAGAATGACTGGGAGTACTCAATCTAC
CGTCACAGCTGCTTCACGCTCGGGAACCCAGGAAGGAtcgaggagatgctggatTACGACTCGTTGTCCcccagcaccagcactgATCAGGCCGTGGCGA
TGCCCAGCATCGCGTACAGCTCCGAGTTAAAACCATTGGAAGTCCGATTGAGTCTTCCGGATTCGCACTCACAGTCTTGGGAGGTTACTGTTGCGCCGAG
CGTCCTACCACATCCAACTTTCGACGCCACGGAGACGCTGCTCGAGAGTGCTGCATTCACAAACAACTCCGAGGGACATTCGTGGGGAAGTATACTCGAC
ACCACGGACGAGTGGAGTGATCCCGACATGAATTCGCCACTGTGGTGGTCTCAGCGCAGTGATTTCTCCAGCATTTGCTCGGACGACCTGTCCGACATGG
ATACACTCTCTCAGATCAGCTCATTCTTCTGCTAAAACGTGGTGATAAGTCTGTTTGCAATCGGATAACGGTATAAAACAACACGATGGTCGATGAGCTA
AATCACCTATATCATCACATAGGGAGGATACATCAGAATGGGGGAAATTGCGTACTCAGGACGGAACCAGGCAGCCCTTGTTGATGTGCATATGAATTTT
TCCATCTACCTTACACGGAGTTCTTACGCTGAAAGTTAGCGTCGGGGTCTGATCGATCGCCACTCAAGCTTTCGTCCTCAGTCatcgccacctgcaccga
GTTGAACGGGGCAGCCGACGACGGTACTGCTTCACCCGTGTTCAGCGCTACAGAACCATCGTTTGCGTCGCTGGAGACGTCAACTCCGTAGAAGTCATAG
ATAGTCTTCACCGTGACCTCCGAGTCCTTGTGGTTAATGTCCTTGTGGTAGGCCTCAAACGTCACCCAAAACAGCGGCACGATGTACAGCGCAGAGAACA
CATCGAGTGTGTAGTGCTTACGCGATGCCACAATCAGGAACGCGATGGCGATCTGGACGCTCACCATGATGGTGATTCCGTACTTGTTGGGCCAGTACTT
CCAGACTGTGAGAATGAGCGACACCGTGTAGATTGTGTGCGAGCTGAACATCAAGTCGCCGCAGCCGTTGAGCGAGTCCAGACGCGTGAACCACTCGCTG
ACAGTGGGCGGGTTGAAGTCCGGGTTGGGAATGACACACGGCACCGGGTCGTCTGGGTTCGCGGCCAAGCACGTGTCGTTAAACTTCAGCTCACAGTGAG
CGGCTGGGGACGGCAGGGCCGTGACGAGGAATGAGATGCAGCGGAAGATCAAACAGATGCTAAGCTGCATCAAGCAGCGCTTCAGCACGATCACGAGGTA
GCGCGGACGGCCAGGCTCCTGTCGGAAGAGTGGGATCGTCAGAACCAGGATGATGGCTGGGCCGAAAATGGCAGCGAACACGAGAATGTCCGAGAGGTCG
GCGGCAGTGCCGGTCAGTTCCGGCATGAGCTCATAGCCCAGGTCATAGAGCGTGAAGCGCTGCTCTGTCGTGAGGTAGTGGCCCTGGATGTAGTAGGCCA
AGTTGTGGAAGATGGCGTGGACGTACTGCATGATGACGCACGGCAGGATGATCTTCCACTCCTGggccagcaactgcagctcgaTCTTCACATAATTAAT
GAAGTTTTCCTTGTCACGGAGCTGCCAACGCCTCCCCATTATGTCGATAGCGTTTTAGTTAAGAGAACTGGACGGTAGAGATTGAACTGTACATTTACAC
CGAGACCAGAGTGAGTTTATGGTCTTATTCCATGGGAATTTCAGGCCGGAGACGTACCTCGGAGCTGTGTGCTGCGTGCTGCCGGTCTGGTTACCGAGTG
ATGCGTCCAAGGCTCCAAGGGACCTCCTCTTCCGCGTGTGGAACGGCGCTGAACGTGCGCGCTTGGGCTGCTGTTTGGTTGTGAGAAGCGCTTTCCGAGG
CCGCAAACAGGCCAAAATGGCGATTGCGCCTAACTATACCGACCGTAGAAACCGCTGACAATGAATACTTTGGGAACATCGTACTTCAATCATGGCGCTC
TTCTTTAATTTGTCTGGCTTCTCTGACATCTGACTATTGATATCCTTGTTATAGCACTATAATTAACAATCGCTCTGTTTTACGGGGATTACGCACTTTG
GCGATCATTTGGAGCGATGTTGTCGCAGATACCGacttgctgttgccatcGGCTTCATGGGCTTCACTTTGCTCGATGCAACGCGCAGGCAGCAACATGA
CACTGCCGTTATGGCAGTCTTGCCGCCGTGTCACTGGTTGAAGATTTCCTCACTCTGCGATTGAAACGATCCTAATGATAGGAAGGTGATGCCGACTCGG
CAGTTTCGACGCTAAGCTCTTCCGACTGGATTTTCCTCCGCTGCGTGCGACTCCGACGAGCATGAAGCGACTGGCGGGTTCTTCGCTCCATGACGATGCG
ACTGGGCACGAGCAAGAGCGAGGCGCGAACCTCCAACTTGCGCAGAGGCACCGCAAGATCGCCGCCGGCAGCTTCAAAGGCCGCAAAGCGTTGGAACCCG
AGTTCGCTACACCTGGCGTGATTGGAAAACTCGCACTGAGCTTTACAACCTCCGGACCTTTGACGAAGCACACGAGGATCACGTGCCAATTGCCAGAGCA
CGGGTGGACACTACCGATATCTTCGCCGCTAAATGTCGTGCTCCAACTGCCGAATCCGAGCGAGCATGCGGTTACTGGTGCGCTGCCGCAGGTGAAGATG
agttggagctcttcgactAGGACGATGGAGTTTACACTGTTGAACGAGAGTGTAATACTGGCTGATACTCCACTGGTGCTGGTAGTGTCGGGGGTTAGCA
CCCCGGAGAAAGCAACACCACAGGGTGAAGCTATCGTCACGAGTTTCGAGAAACTTGTAGTGAGGAACACCGTTCCAGCGTCTACGCGCGGTGGACAGGT
TATTGATGGCCCCACTGCATTTACAATACCGAAGATAGTGCCGGGGTCCATTGGTGGAGCAAAACGCTGGAGCCCGTTTAATTGCTGTCCCGGAGCAGTG
TCCGATGTGGCATTGGCGTTTGCAGTCAATGGCAAGATTCCGTCGGGTGGGAAATTGTTGATTGAGCTGCCACCACACGGATGGGATATGGATAAACAGC
CAAGGGTGCTGCTACGAACTCCGGTGTATCATAACGAAGcattggcagcttcgtgggACTCCAATCAACACACTCTGGAGATTTTCTTAGGTACCGATGG
GACGTCTATTGATACGAGAACGAATGTGATTCTCACGATTTCAAAGGTAAAAAATCCCCAAAAGGAAACGATGTTCTTGGCCGCTTCGACCGACCCAACG
ACTTCCGCAGCTCGTCTTACCACGTTGTCAGCCAGTGGCGGTGTGATCGACGGCCCCAGTCGAATTGAAATGGCGCGAATTAGTGAGCTCCGTGAACGTG
ATTTCGACGTACTTACCGAAGTACttgatgcagatgcagcagaaaacCCGTCGACTGCTGAAAATGGCATCGCAATTGACCGAGTGCCAGATCTGTTACG
CCGAGCAGGTCTTAAGTTGTCTGACGAACTGTATCAGTCACTTGTGGTTCCTTGCTTCCCAGCACGTCACGATCCTCCAGTTGTTAAGCCCGATAGCAGT
GGATCTCTACCAGCAGACAACACAACTGAAGTAGTACCCACCACGCCACCTGATGGTTATTTATCCCGCGAAGAACTGCTCAATGTGTTTGCTCTTGTGT
ATGCTCCGGCTTATAAATATGGTCAGGAGCTGCGTTTGGCGTGTGGTCGAGGTCACGCCGACCGTGTGCGGGAATGGATTAGTCGGGGTTGTAACCCGaa
cgctggagacgcttcCGGGTGGTCAGCGCTGCATTACGCGGCCGACTACTGTCAGCTGGACGTGATCAATCTACTCGTCGAGATGACAACAGAAAATGAC
ACCAACGACACCAAAACTTCAACACTGGAAGTCAACGCTCGAGACGGTCACGGATGGACGCCGCTTATgtgtgcagcagccaacggccacgtcgacgtca
TCCAGAGGCTTCTAGCTCTCGGCGCAGACGTCTGTTTGACTAGCGCTGAGCATCGCTCCGCACTTCACTGGGCAGCAAGTCGAggaatggctacagcagT
ATCTGAACTCCTCGCTGCCGGTGCAGACGCGTGTCAAGCGGATCGTTGTGGCTGGACTCCTTTACACTGCGCGATGCTGCACGGCAACAACACGTGTACA
GCCATTCTCACTGATAAAGGCGCCGATCCAGCGGCAACAGACTCGTTGGGCTACATGGCTCAGTTCTACGGCGACGCCTTCCTCTCTCTTGATGCCCAAC
AAGTCTAAGTCGCTTCAACATTGCTGTGATTGGGTAAAACTATGTCCTCAAATCTTTTCTGGTGGTCAAAAAAAATTGCTTGCGCAAACGCGTCTTATTT
TCCGCCAATAACAGCGACTTTGAAGTGGTCTAACGATCCCATTGCAGTCCACAAGAACTCGACCActtccaggagctccaagctTTAGGTCTCATTCCCC
AAGTCTCTCAGCCATGCCCACGTCCGCAGGAGCTAAAGTTCTGGCTGAGGTGTACCGCCTGCACCACATCCCGCTGCCGCCCATCacgctgcaggcgctg
ctcaagcgcggGCCCCATGCAAGTCCCGTCATTGCCGCGTCACTGCAGAACGATCCGCAGGCTCTTACCAAATGGCGCGAAGTGAATGCGCCCGCCATCG
TCACATCCGCTCAACTGCTGCACCGCGAGGCGCCGATCCGCATTGCGCGCCGCATTGTGGACCTCGAGAACCTGCCGGACGAGCTGCCGCAGGCGAAGCC
CATTGTGTCACTGCGCGAGCAGCTGttggagagcttcgaccagctcACGAGCTGCCCGCTGCCTGCCAACCTCGCGAGCGAGCGGGACTTTGTGGAGTTG
CACCGTAAGATCCGCAAGGAACACGCCACGATGCACGGCAACATCGCTGAGGCCGTGCAAGCGCTCGAGTACGAGCCCCAAGGCCTCAGTGAGTCGCTTG
ACAACTTCTACAACTCTCGTATTGGCATCCGGATGCTTGTGGACCAGCACATCGCGGCACAGACGCCTACGCCCGGCTTCACAGGTATCGTGAACGATGA
GACCTCGCCGGTTAAGATCGCCCGGGACATTGTGCACAAGGTGCGTCCTCTTTGGCAGGACAGTCTCAACGGCGAACAGTTACCCGAGATCATTGTCACT
GGggacgaagaagccactTACCGCTACGTGCCGCAGCACATTGAGATCATCTTGACGGAGGTATTCAAGAACGCGGTGCTGAACAGCGTCGCGGCTGCCA
AGAGGACGGGAGCTACGACGCCTCCACCTATCAACGTGCTGATCTCCGGTGGACCTCATGGCGTGTGTGTCAAGGTGTCGGACCTGGGCGGTGGCATGAC
GCGCAAGGAGGCCAACGCGCTGTCAAACTACTACCACACGGCGACATCACCGCCCTCGAGCGGCTATGACCCTGTTGCGGATGTCTTGGAGAGGCGTGCT
AGTGGACTGGACTTCTCGGACTCGTTCGGCTTGCGTATTGCTCAGCTCTACGCTAAATACTTCGGTGGAGAGCTGGCGATCATGCCCATGGAGGGCCACG
GTGTGGACACGTATATTTACATGAACTGCCTCACTGGCGCCTCGGAGCTCAAGTAAGTTAGGTCGATTCGCTGTGTGGTTCGGAATCAAGCAGATggaga
aaaaaaatgcagTGTGCATGGCCCTTGTCActaccttcttcttgttgtacCTGTCCAGATTCGAAGCACTTTATTAGCAACAACGGTTTCCTATTTTACA
CGAGGGGCACAACCTGATGCCATGTACAGTCTTCCATTTCGGCTGCTTGTTGTAGGCGATTTGGATCTGCAAGACGCCGTTCGAGGCGAGCAACACGATT
TGAGTCCACCTGGAGTCGTCGACAAGTCCGACAGCCAACCTCTCTGGAAGTCGAAAGCGTAAGTGCCGTGGAAACTGGAGCTTGACACCGAAACTAACAA
TTGTCTGTTGCAGTAACACCACATTTCCACAAGAGCTAGGGTTGATCTTGTTAGAAGCACAACCTGCGACGATTAAATCTCTTTGTGTGACAGTAGAACT
TgccagagctccagctcggagTAAGCGCTGCAAGGGAAGATTTGGCTTTACAAGTGAAAAACTAACAGTAGTCGCCTCTTTAGTTGAAGTTTTTGCAGCA
TTGACACAACGACATACAAGAGCAAATGCACTAAACCACCTAGATGCTGTATCTCGTTATCTTAGTGCTGACTGGAAACTATGTTGGTAAGTTTAAGTTT
AATGGATATTATAGTGCGATCGCTGACTTcagtctacatgtacgtgaaCAGCGACCCTTTAGTATGGGAAGAGTGCACACCAGCTAAGATAAACACATTT
CGAGAAATGGACACTAGGGTCGCTCAATTGGGTGTATCCGAGTGCTCGTTCATCAAACTCGTTATCCGAGATCCACCCGGAAACAACTTGCCTCGACAGG
TACTGATAGCGCTAAATCCAAACGGAATTTCGCTCTGATACCGTTTGTATCGCTACAGATTTTGCTGGAAGACATTGAAATATTAGGATCGGCGGAAGAT
CAAAGTCTGGGTGACGTCAAACGTATCGATGGTCGAATCACCAATCGTTCTCCTGCAACACATCGGCCCATACTCTTCACCCTCGACAATGACTACGACG
AGTTACAAtcagtgctgctggatgctggGGTACCGATGGACTTGGTAGTACAAATTGCCAACATTTCTAACAGTGCAGCTGAAATTCCATCTCCAACTCC
CCAGCAAACTGACAGGGATGACTTTATTCAAGAATGGAGGTCTCAAGGCCACCCTGGTGAGAATTTTGGTGCTACTCCGATATCGAAAGATAGTAACAAC
CAGGACAGCGAAAGGGGCCCTGTTTCACCTTTTGATCGAGTACTACGGCTGCATGTAGAACAAACTGCTCACGAGAGAGCCACACTTCAGGAGGTTCTTG
CCACGGAGATACGTTCAGACGTCGATGAAGTGTCTTCATGGCAGCCGCCCACGATATCCCCAACTGATCCAGTAAACAGCAATGAGATCGTGCTGTACAC
CTTTGGAATATTTTTCACGCAGTGCTTACTCTGCGGTGGAGCTGATATTCAAGTTACCTGTATACAACTGGTGGAGCGAACCGTTCCTCTTCTGAAAAAA
TCTCTTGGTGCAACCTCTGCGTTTGAGGGTCTGACCGCTCTGATTGTTCTCGGAGTTCGAGAAGCAAATACATCCCGAGCTTTTCAGTCTGCAATTCACT
TAGCACACACAGTTTTTCAGACTGAGGTGACACGCGAGAAGAAAGTTCCAAAGGAAGTGGAAGTTCAAATGGGAGGACGTGAAAATGACGCGCAATTAAG
GCTGATTGAGGAAGTTGCCAGTGCTAATTGGAGTTACGGCCTTCGAGCCATCCTGGAGTGGACTCTTGCCAGTCCTGTTTGTTGGTCCACGAACTACACT
GGGAAGGCAGTGCCACCTTCAGTCGATAGGGTGTTCCTGCAGTTTGTTCGCTTACTAGTCGATCAAGATGAAACTCGCGCGAATTTCTTcaatgagctcc
ttgatATAATTCCTACAGACAACACCGTGGGTCTAACTGTTGCGCTGAATCGATTGCGACTGCTACGACTGGTGTTGCGCAACGATTTAATTCGCTGTTT
CTCAACAGCAAACGTGAAAACGCGTATTCAAAGCCTTTGTACGAAGATTTTGGATCCACCAAGCGATAATATGGCATTGAAAACCGATAAAATAACTCGT
TTGGCGTCTGAGTGTTTAGATCAACTTGAAGAGCTTGCTTCCGGTTCTCAAAACTTAATACGTACCAACGAATTGGCCACCGTTTACAAACACCTGGAAG
TCTCGAACAGTTCCCACCGCTATTTTCACACACCTTTCTCCATCCAAGACCCACTATCGGACGCCGAGGTGGCGGTATTTaacgagcagctgcagcggta
CTTCTCCATTTTACCTCGTCCAAATGCTCTTTATCGACATTCGTTTGTACGTGCGAGCCAAGTCGATCGTGAATCTTTCCAAAAGGGCAACATTGCCTTT
CAAGGGCAGGTAGTTGAACGAGAGCCACCAAAGGAAACATTTCATCAAGAACTCCAAAGAAAAACGGCGCCATTCGTGTTTAATAtcagcgacaagaagc
tgatcaCTGAGTTGTCGTCGGTGCCTTCAGCTAAGCAAGAAATTGTGTCAAGTTTCGCTGCCTTTAAAGGCACCATAGAACGACGAAGTGATTCCCCAAG
ACGATCCAACAAGGTCTCTCCAGCACAAGAGAAGCAAACTCCACCAATTTCTAAAGCTACAACAGTGGCAAACAACCAGTTCGTGACAAGTACTGACAAT
GCAGTAAATGCTGTACCGACCGGTGTTTCTGTAAACATCTTAGCAACAGAAGCGGCACGCATTCCAGATCTTTTGACTACAAGGAAAACAAGTAAAATTC
CTCGTGCCAGTCAAACGCCACGTGCAACAACTCAACAAGCGACAACCGTGTTGGTACGTAATCTTCCAGTGCCAATTGCAGCCGCCGAACAGAAGTCGAT
ACCACCGGAAAACACAAAACAGTTGAACGCTAACCGCAAGGCTAAAAAGAAAAGCAACGGGAACGCCAAAACCAGTAGCAAAAACGATGGCAAAGACCCG
GATCATTGCGTACTCCAATGAGCTCCTTCGCATTATTCACGAGGTGATTTTGTATCGCCACTGAATTTCTAACGGAAGCTTCCGGATGTAATTTTCCAGA
ACAAACTTTTCGTCAACATCAGCGCAGAGTGCAAGCACTAATTGTTTAGCAGCATCGCGAACCAAGGCGTTCTTGTGTTGGTCTGCATCACTatggagca
ggaagcgaaTAATCCTCCGAGGAGCTATATCGCAGCTTGCACAACAGTGGAATGACAATAACAGTGCTGTCAAGAGTTTCAACAcagccaggagctgctg
atcGGACGGTTCAACATGCTTGCTCTCGACACTTTTTAGCAGCAGGTGCGTCACAAAGGTGCTTCTAGTGCGAGTGGATCCAGCAATCTGAAACGATTGA
TCAAAACCAGCCGTAAGTTTGTAGTTTGCCAAAAGAAATGGAATTTTCTTTCCTTACCTTCAAAAGTGTAAACGCAGCTGTATCGCGGATGGAGGCCTCG
TGAGACGAGAGCCtttcaagaagaacattAACAATATCGACGAGCTAtaatacagtacatgtaccatgaGCATGAGTTTAGCTGAGTAAGTCTTTCAAAG
GCAAAATACTAACATCCGTTTTTGAAGACATCGTATCTTGGAAGTATGGCGAAGAGCTTAGCAGCGCTCGCAAGAAAGCACAGCCGGCAACAAACACTTG
AGCGTTCGAATCATTTAGTGCGGTGATCAGTACCTCAGCAGTTACTGTATCCATCGATTCGAGTTGGAAATCGggttgtccttcttctctggAACATCGC
TGGGGACATTTAGTGAGCTGCCATAATAGCGTTTCTCTTTCTTGCCAATGACCGGTTCGTAACTTGTTTAGCACAACATTAGCGTTGAATCCTCGAAATG
CAAGAGATGCCGGTCGGTCACTGCTGAGTGGCTGAACTTTCGACGAAGAAACAAGCTGGGAAAAtctctcttcttcacgctgtcTACGCTGTTCAAGTCC
AGCAAATTTCTCCAATGTATCGCCCACATTCGAGCGTATCTGGTGCTTgttttctacatgtagtaaacCCATCAACTTGTTGGCTTCTTGCTCCAGTAAG
ACCCACGGTTGCACTAATTTGTCATCACCAGCGAATTGAGCTAACTGCTTACCAATCTGAATATCGGCATATTCTTGCTCGGGTGTCTTGTGTACTCGAG
AATTTTCCGTCGAAATATTCACACGCGGTGATTTAACAGCAACTTGTAGCACCGCTCCAGACGTAGATGTGTCATAAATACAAAGGTTTCGTTGACGAGG
GGGCTGGATGTTTTTATCTGGGCTCTTTCTCGGAGATGGTATCACGGGCAGTACCAGAAACGTCTCCTTTGGAGCCTCCAGCGCTGCTACCGACGCCAGC
CCAACTTGACTGAAGAGATTCGTCCGTGTTTCATGGCAAgaatgcagcaacaaacgTAAAAGAGTGATTTTAGCGGTTGGTCGAGGCATTTGAATCTCTT
GTAGCTCGCATGTTGTGAGGTTGATGCTGTCACTATTGAGAAAAGACACAAAGCCAAGCCTTTCAAACCTCACCCCAGTCTTGCTATTGTGAATTCCGTC
ActcgcagctgaagacgtgAAAATTTCTATTCGAGTTGCCACTTTGAAGGGATGAGAAAGCAGATTTACTTGCTCAATACGCGTTGCAATCCCTCGATTA
ACTCGGAATACCAACTCCTGCGGAAACTCACAGAACTTCTCGGATTCCCACACAGCAAGTTGAGGACGCGTTAGGTTCGTCGCAGGGAAGTGGTCGTCCT
CGCTGGAGCAGAAAACAAGTTCCAGATGAGCGGGTTCCATTTCATTATCCATTTTTTTCatactaaaaaaaaaaactaaatatacgtcttcaagttgctT
TTTTATCGTATGCCATTTGACAGTTTCTCAGAATGATGGTATTTTATACGTGGTGCACACCACTTTACAATTTTTGTTCCAGAAGGTCTCAGTCATAAAG
TTTTTTGTTGTTACGAAAATGCCGACACTGAGCGACGAGGAACAGGAGCTGATCCAGAAGGACCGAGAGGCCAATCCCGGCTGTTTCTACTCAACGGCGC
TATCCCAGTCCTGCAGGTCAATCAATGGCGACAGCAAGTGCgagatcatcaagaagatcttcCGCCAATGCCCTAATACACGCAAGGAGCTCATCTCGAA
CCGCAAGGAGATCACAGAGGACGAGCACGggggagaagctgcggctggAGACTTTTTCAATAGGGAGAGGATGGATCCTCGTAAAGGGTACGTTCATGGC
TGCAAGTAATGTCGATTGTTTTTTTTGGTAAATCTTAAATTGATCCCTGTGAAATTCTACAAATTCAGCGGCGAACAGGAATTTAGCAACTTTTTCCAAC
AACGGTGAGTGGACATGGTTCATCGAGAGGTGGCAAGTGAGGATTTACTGGTAATCGGCTAACTTTTGCTGGATTGTGGCACAGAGGTGACGATTTCGAG
GCCCAAATGAGCCCATTCGACTTTTTAAGACAAGAAATGCTGCGTCCGTTTGAAGGTACGTCACAAGTTTGCTAGAGGATCCGTtgatacttcgaagtat
aaTGCTTACTACTGGCCACTATTTTCTTCAGACTTCTTTGGTGGTAGCTTGCTGGGGAGAGGCGACTCGAACCCGTTTGAAGGACTCGAGGAGTTTGAGC
GAATGCCGATGCGTCCGCCGTCGCCGACGCCGCATCGACCATCGCGCCAGGCACCGTCGAACCCGCCACATTATTCGTTCCAGCCTTCCCAGGGCAGAAG
TTCCGATGGTAGGTTACTTGATCAGGTGAGAAGACTGGGTTGGTTACGATCCTAACATTCTCGATGCTTTTGCTGTGAAGAAACCAACGCAAAAGAGCGC
GCACAAGGCAAGAGCGACATGTTCGCAGACTACTCCGGTCGCGTGGAGGAGATATAGGAACTGCATGACAGGAACAGCGGCTCTAAGCGATGCGGTCTGA
ATGATTATGCCCATGACCGTTCTCGGGTGAACTCGAATAGGTTTCTTTGTTGAATAGACAACCATGTTGTTACCAAAAAGGGATAGGACGACTTGACCAA
CGAATTATCAAAGTGTTACGCTGGGGTGAGAAAGACAGAAGTCCGAACAAAACACCCTGTTAAATCTAGACTAGAGATGCCGGAGTGGGTTGATCAATTG
TAGCTAGCTACACCGCATCGGTCCGTTGAACTGGAAGGTGTTGAACCCAACCAAGAGAGACTGTGCATCCGTTTGAATCGAGCTGTAATGTTCATTTCGG
ATTTGGCGGTGAAAGACCAAGAACACGAGAAATGGGTGGGGGAGATGTTGGAGCCGCATTTGAGGCGACGTTAAGGCGGATCGGCACGCAGTTGGCGCCC
GAGGATCTCCCAAAGCTCTACCCGTCTCCACCCAGTGGGGGAGAAATCGATACGCCGATCGTGCTGGAAGATTGCAAgttcttcgatctcttcgacACGG
ATCCTGTGGAGGCCCGCAAGTTAGCAGAGCGTCAACGCGAGGAtgcaatgcagcagcacggcgctTCGTACACGAACCAAATCCTGATGTCAACGACTCA
CCACCCGCTGAAGAGGGTGCAGACCACCGACTACCGTCTCACTCCAGGTGAGAAGGCCAAGCTTGCAGCTAATGGAGTCGTTGCGGTGGAGCGTATGCCA
GCGAAGAGCTTTGCGGACATTTACTATCACCTCTACACGGACGACATGCCGGTGTTTGTGACAGCAGACTCAGTTCTGCACGCGTGGCACCGCAGCTTTG
ACTCTTTTCTCGTGGATGTGGAGGTGCAGGTACTGTCTCCCACACTGGATAAAATGCTCGAAACAAGTCTTGCAACATGCGTTGAAGCCATTGGTGTTGC
TCCAAAGGGTGACTGTGACACAGGAAGAGCGATGGTTGACGTTGAACTCTTTCTCTGCGTGGCACTCAGCCTCTTGCGAGGGAAACCAGCCAACGGCCTC
ACTGAGAACAAGGCCAAGCTAAAACACTTGCTGTACTTAATCCACAAGGAGGAGACAGTAGAGACCGAGATATTGTCGGCCACGCGTGAAGTCGATTTCT
CGCAGTTTAAGCCTCGTGGACACTACACAAAATCCGAGGAGCTGATGCGGTACTTCCGATCCATGATGTGGCTCGGGACGATCGATTTCCGTATTGCTGG
CGGCGAAAATCCCAGTGACGATCTGTATCAGCTGCTCTGCGCAGTTACGTTGGTGAATTTTCTTCAGAAATCAAACGTGTTGGAAGTTGTGGAGGGCGTT
GACGCGCTGATTTCCAGCTTGGTGGCCGATGGAGGAATGGGGGCCGATTCGCTCTCTCCTGCTCAGCTTTCGCCCTTGCTGTTAGCTTTTAACTGCAAGA
ACATGTCGCTGGAAGACATTCAGAAGCTGATCCTTCAGAAGGGAGTAGGAGCCCAACTGATTAATGGCCACCCTCGAACTGAGTTTGAACCTCTGCTGTC
TTCAACGCCGATGACTCCACCGACGTCattcgctcttcttggacagcGGTTCGtctggagctccttcatcttctcgcgGTTAGTCTTCGACCACGTTCTC
TTCGACGATGAAAAGCAAAAGCGACGCATTCCAAGCGCAGTTGATGTCGCCTTCACCCTCTTTGGTAACGACAGTGCAGCTCAAGTATTAGCTGATCGAA
TGAGTGCTCAACCACTAAAAGGTGCTGATTCGTCGGAGTTTGTTCCGTTTCGAGATGGCATCCCGTTCTCGTCGAATCTTGTAGCACTGCGTCAACTTCT
GGATCAGGAAtttgacgacgaagacgtcaaaAGTCCACTGGATTCTGGAAAAACAAGTATCAGTATGTTATGGCAACGAGCTTTACGTGCCCTGTCACGA
CCGTCTCCGAACCCATCGAGCACATTCCATTCCAATGTTTGGCGCTTGCGCCAAATGAATACGCAGCTGGGGTCGTTCACTCAACTACGACATGACACTT
TGCTGTACGCTAAGCAAAGTTACGGGGTGAGATGTGGCTGCGAGTATGCAGACGGTATGGTGGATCCATACCCCCTCTTCTGGCAGCGAATGGGAGAGCT
TACGAGGCAAATGGTTATCATGACTGATACGGTGTTGGCACCATTGGTCGAGTTTTCAGTCGAGCATTCACACAAGTCAATCAATATCGACTATTCTTTT
TTCGACAGCACATGTGTGGTGGCCAAAAGCAAGCGGTTTTTCCGATCTTTTGCGGACACCATGCAGTCGATTGAAGACATTGCACGTCTCCAAGCTGAAC
ACGAACCTTTACGCGATGATCAGGTGAATTTCCTGAAAACAGTCATGGAAGAACGATTCGGAAGTGGTGGGTCGCGATACTTAGGGTGGTACCCTGGACT
GTTTTACGAAAGCCGTGAAGACTCAggcaagagcgacgtcatTGTTGCCGATGTTCATACAGACTCGCCATCGCCCGAACACATGAACCCAGGAGGTGTG
CTTCATCTGGGTGTTGGAAACCCATTGATGGCTTTCTTTGTCGTGGACAATACCATGTTTGCAGGTCCAGTGTTCAGCAGTTATGAGTTCGTGACACCAA
TCGACAAGCGTCTGACGGACGAGGACTTCGAACGCAAACTGCCATCTATGCCGATGCCTGAGTGGGCGCGTCGATCGTATATGTGCTAGGAAAGTTGCct
ttttctctttttttttactagTAGTTGTACCGCGAGTGGTTAAGGGCTAGTTGAAGTCCATGATGTAGGTATCTACAGTTGACATCGAATGCCAGTCCTT
GTTGGAAAGCTCTGCTGGCCTCCGCAAATCTCTCAAGACCGCATAGAGCGCAGCCTTTTCGGTAGTATCCCTAGTGGAACGCGCTAGTTAGTGGTGACtc
aaaaaaaacaaaacaataaAAAGACATTTCACGTACTACAGTCGACTTTGGGTCCAGCAGAACAACCTGCTCTGCGTCGTGTAGTGCCGCTGAATAGTTT
CCCATTGCTGCCAAAAGCGTTGAGCGTCTTGTGTACATGATACTCAGGTTCTTTTGCGTTTCCGTGTTTAAACGGATGATTTTGTTGTACATCTCGAGCA
TttcctccgcttcttgcAGAGGAAGTGCCGTTGCCGAGTCAAGTGCCAGTGATGTTAGTGAAAATCCCCTCTTTTCAACGTTTTCCGAAATATCACCAGT
GCGACAACGTGCTGTGTTCTTGGAGTATAGCGAAGGTAACAGTGAAATAGTGGCTTCGGTAGTAAAGTTGTGCTGGTGACGAAGGGAACTGGTACTTTTA
GAGGCTCGTAGCAGCACAGAGTCAAGCTCTTCCCCGGATTTAATGGTTGGATGCTTTGGtgaagacagcaacgacatGGACTTGGTCAATGGCGACTTTT
GCTCGGCAAGCGAAGCCATTTTCTGGGCAAATTCGATCGACTCGAGGTGCGGCCGTGAGTTTCGCAGCGTTAATTTGTGCGCATCACAAACTGCTTCGTT
GTATCGGCCCCTCTTTGTGGCAGCAACGCAGTCACACCCGAGAAATCCAGGAGTGGCAAACGTTTTGGTCACAACAGTTGAGGTTGGGCGATGTCTAGCC
ATCTGACTATCACGAAAGCCGTTCAGGAGAGGATCACACGAGGCTTCATCACTGGACTCCTCTGT