Description :
From Genome Similarity Track
Location :
Scaffold_15:38745- 39823
Transcript NameFunction/comments
Physo_131238hypothetical protein

Sequence
1078 bases(100 bases per row)
CCGCCTCTGCGTTCTCGTGCGACTGCATCGCCTCGAACCCGTTGCGTCCCGTGACCTGGCGCAGGAAGTCGTACAGCAACCCGCCGCAATTCAGATCGAG
CTCGTCGACCCACGTCGTGTCCGGGTAGCCCTTCCATCTGACTTCGAACTCGCGTCGCGTGCGCCCATACCGGGTAGCCCGCCCCTCGCGCACGTTCACG
ATCTTCTCGACCTCGAAGACGTCGTCCTCCAGCTCACACGTGTCTACCCAGCTATCCTCCGGCAAGAGCTCCTCGTCGAAGTCGAAGCGCTCCTCGGCCG
GCACCGTCAGCTGTGTCGCGGGTCGCGACGGGAATTCCCGGACGGGCTTCAGCTTGGGGATGTGGACGACGGGGTACAGCTGATAGGGCGTACCCGCCGT
CTTGAGGCGCACTGCGAACGCGCTGACTAGCTCGGCGACGCGGAAGGGTCCGTGCCACATGTGCGCGAGTTTGCGCGCATACCCCGGCTTCACCCGATCC
AGGTACAGCCAAACTTGCGAGCCCGTCGCGATCTCATGTTGCGTCGCGTTTTCAGTTTGTCGACGCGCTCTCTCTTCGACGGCCTCTCGGACTACTTGTG
CCCTTGCCACCTTGTAGTGTCGTTGAATACGGAGCCTCCACCGCCTCGCCTCGGCGTCCCGGGTCGACGTGTTCCCGACGGCCAGCGTCGCTTCCAGCGT
CGACCGAGGATCCCAGCCGTGCACGAAGAAGAACGGGGTTTCGTTCCTCGTTCGGTCGTGCGACGTGTTTAGCGCGAAGGTAAGACGCTCGGCGTATTCG
TCCCAGTCGCGTTGGTCGACGTCCGCGATGTACATCTTGATCGCTCTTGTAACCGTCGGCACCATCCGTTCTGCAGCACCGTTGGCTTGGGACGATAAGC
GAGCGTCGCTCGCTGTCTCTGACCCATGAGTTTGCTGAACACCTTGAAGAAGTCGGACATGAAGCCCGGCTCGCGGTCGTGGCAGATAGCCTCGCTCGCG
CCGAAGCGCATAAACACCCCCTCCTCGTACGCCTCGGCCACCGTCTGCGCGGTTCGTGACGCGTTCGCTTTGACCACG