Description :
From Genome Similarity Track
Location :
Scaffold_15:38742- 39819
Transcript NameFunction/comments
Physo_131238hypothetical protein

Sequence
1077 bases(100 bases per row)
TCGCCGCCTCTGCGTTCTCGTGCGACTGCATCGCCTCGAACCCGTTGCGTCCCGTGACCTGGCGCAGGAAGTCGTACAGCAACCCGCCGCAATTCAGATC
GAGCTCGTCGACCCACGTCGTGTCCGGGTAGCCCTTCCATCTGACTTCGAACTCGCGTCGCGTGCGCCCATACCGGGTAGCCCGCCCCTCGCGCACGTTC
ACGATCTTCTCGACCTCGAAGACGTCGTCCTCCAGCTCACACGTGTCTACCCAGCTATCCTCCGGCAAGAGCTCCTCGTCGAAGTCGAAGCGCTCCTCGG
CCGGCACCGTCAGCTGTGTCGCGGGTCGCGACGGGAATTCCCGGACGGGCTTCAGCTTGGGGATGTGGACGACGGGGTACAGCTGATAGGGCGTACCCGC
CGTCTTGAGGCGCACTGCGAACGCGCTGACTAGCTCGGCGACGCGGAAGGGTCCGTGCCACATGTGCGCGAGTTTGCGCGCATACCCCGGCTTCACCCGA
TCCAGGTACAGCCAAACTTGCGAGCCCGTCGCGATCTCATGTTGCGTCGCGTTTTCAGTTTGTCGACGCGCTCTCTCTTCGACGGCCTCTCGGACTACTT
GTGCCCTTGCCACCTTGTAGTGTCGTTGAATACGGAGCCTCCACCGCCTCGCCTCGGCGTCCCGGGTCGACGTGTTCCCGACGGCCAGCGTCGCTTCCAG
CGTCGACCGAGGATCCCAGCCGTGCACGAAGAAGAACGGGGTTTCGTTCCTCGTTCGGTCGTGCGACGTGTTTAGCGCGAAGGTAAGACGCTCGGCGTAT
TCGTCCCAGTCGCGTTGGTCGACGTCCGCGATGTACATCTTGATCGCTCTTGTAACCGTCGGCACCATCCGTTCTGCAGCACCGTTGGCTTGGGACGATA
AGCGAGCGTCGCTCGCTGTCTCTGACCCATGAGTTTGCTGAACACCTTGAAGAAGTCGGACATGAAGCCCGGCTCGCGGTCGTGGCAGATAGCCTCGCTC
GCGCCGAAGCGCATAAACACCCCCTCCTCGTACGCCTCGGCCACCGTCTGCGCGGTTCGTGACGCGTTCGCTTTGAC