Description :
From Genome Similarity Track
Location :
contig_24:38735- 40716
Transcript NameFunction/comments
g5600.t1hypothetical protein

Sequence
1981 bases(100 bases per row)
GCTTGTGCACCTGCATGAGCCCGCGATTCTGCAGGTGCTGCGTCGTCGTTTCTTCCACGGAGAGATTTACACCAGCACAGGGCAGATTCTGGTCGCTATG
AACCCGTTCAGACGTCTGTCGCTGTATTCAGACGACATCAAGGACCGGTACTATAACCTGGGAGGAGACGCCGAGGCGGACAAGAGCATCCTGGCGCCGC
ACGTGTATTCAGTGGCGGACCAAGCGTTTCGCACGATGCTCGTGCCGCAATCGAGCGACAAAAAGACGAACCAGACGATTCTCGTGAGTGGCGAGAGTGG
CGCCGGTAAGACGGAGACCACCAAGCTCATTATGAACTACTTGGCCTACGTGTCGACGAAGCGCACGCGCCGCCCGATTCGAGAAAGCAACTGCGACCAA
ACGACGATTCACGACCGAGTGCTCGAGTCCAACCCGATCCTAGAGGCGTTCGGAAATGCCAGGACGACGAGGAATAACAACTCCAGTCGCTTCGGGAAAT
TCATTAAGCTGGGTTTCACGTCTTCAGGTGAGATGCTGGGTGCTTCTATCTCGACGTACCTGTTGGAGCGCGTGCGTCTTGTATCGCAGGGCAAGGGTGA
ACGTAACTACCATATTTTCTACGAAATGCTCGGTGGGAGCTCCCCATCGGAACGTCAAGAACTGGCGCTGCAGGACGTGCATGGTTACGCTTATTTAAAT
CAGTCCGAGTGCTATGAGCGCCTGGACGGCGTGGATGATGCCGAGTCCTATCAGGTGACCCGGCGAGCCATGTCAAGTATCGGAATGAACCCTGATGAAC
AGGTCAATGTGATGAAGATCGTGTCGGCCGTGCTGCATTTGGGAAATGTAGTTTCACGACTGCCACGCGCAATGGCGGGAAGGATGATGCCTCTGTCGTT
GACATGGATGCATGCGGCGACAACATTAAAGCTATTTGCTTACTTCTCGGTGTAGAGGAAGACGTGCTACGGAGTACGTTATGTACGAAGCAGATTAAGG
CTGGCGCCGAGTCCATCACGACTCGTCTGCCAGTAGCGCAGGCACTTTCGACGCGAGACTCTGTGGTGAAGACTCTTTACTCAAACCTATTTAACTGGCT
TGTGGACCGCATCAACCGGAGCATCGAGTACAAGGAAGAAGCGGGCGGCAGTCAGTTTATTGGTGTCGTTGATATTTTCGGCTTCGAGATTTTTGAGCAG
AACCGTCTCGAGCAGTTGTGTATCAACTATGCCAACGAGAAACTGCAGCAGCTCTTTGGTAGGTTTGTGTTCCGTATGGAGCAGGACCAGTACGTTGCTG
AAGAAATTCCCTGGAAATTTGTGGACTATCCGAACAATGACGTGTGTGTAGCCCTTGTGGAAAAACGACACATGGGCATCTTCTCTCTGTTGGACGAACA
ATGCCTAATCCCGCGTGGTAACGATGAGAAGCTGGCTAACAAGTACTACGAATGTCTTGCCGGCAAGCACGAAAGTTTCTCCGTGACCAAACTCCAGCGT
GCGAAGGGTCAGTTTGTGATTCACCACTATGCCGGCGATGTGTGCTACATGACTGATGGCTTTTGCGACAAGAACAAGGACCACATGCATACAGAAGCGG
TGGATCTGCTTCGTACCTCCAAGTTTTCCTTCGTTCGTGCTTGCTTTGCAAACAGCGTCAATACGACCGGAAACGGCAGCCCCAGGAACGGTCGGACTGA
GTCACGTGGAAGTGACTCCACTCGACGACGCTCCGGGGGTATGCTGTCTTCAACGGTTGTAGCACAGTTCAAGAGCCAGCTAAGCTCATTACTGGATGTT
TTGAATGGGACGGAGCCCCACTTTATTCGTTGCATCAAGCCAAACGACCAGGCGAGTGCGTCGCAGTTTGAACGGCGGCGTCTTCTTGAACAGCTTCGTT
GCAGTGGTGTACTGGAAGCAGTCAAGATTTCACGCAGTGGCTATCCTGTGCGTTTCCCTCATGAGGTATTTATCAAAACGT