Description :
From Genome Similarity Track
Location :
Scaffold_221:3873- 9132
Sequence
5259 bases(100 bases per row)
ACTTTTGGAAGCTCGCACACCACCCCGGCGACCGAATGAACCCTCGTCACCAGCGTACATACGTCGCATACGGCTCTCCAAACGTGGCGTAACTATGTGC
GAGTCTTGAAAGTACGGTGAAGCCTCGGTAGTGTCAAAGGCACCCCGGTCTACTCCACGCTTGGTCGGAGGAGTATGGTCGAGTCGTTGGGGGTGTCTGC
GGCAGCGGAAGCTTGGACGGGTCTTCGTCATGAATGGTCGGTCGACTCACAGGCTGTTCCAGCGTTGATGTCCACTGCACCAAATGCCTTCCGATGCTTC
TTCTTCCATATCTGGAGAGCAGCTCCGACCTCATGAGGACGCCCATCGTGGAAGCAACATCGGCAATGGGTACGTCTCATTCTCAAAGCCCATCGTCATT
AGCAGCGAGACTGACACCTCGGCAACCTGGCTAATTGAAACTGAGCTGACTGGGTACTGAAGTTTCTGCGCAAGCGCGGGCCAGTCGGCCTGTCTCTTGG
GGACGGTCTTGAACAGCTACATCCACTCATCATTCTGCATCAGCGCTTGTACGCAGTCGAAACCGCGCTTGGTGGCTGGTGTATCACCGTTGATAGATGG
GCGAGGTTCCTTCAGCAATGCTGAACGCTTTGCACTCGCCACCGAAGGTTTAGAACCTTCGGTCCCATCGTCATATTCTTCATAGACCGGTTTTGGTCAC
GCGACGTTATCTAGCTCGTCGGCGAGGTTCTTCGAAAGGAACCTGGTCGCCATGCTCAGCCCCGATGATAGCGTGGCCGTGTCCGGTTTCGCTGCGCCTG
GCTCTGAAGCCGGCGTCTTGTCTTCGTAACCGTCGTAATCATGGGCCTCAGGAACGTTGTCCGCCTCGTCCACAAAGCTCACCGAAAGCTCGGTGGCGGC
TGCAAAGCGTGCAGCCGACACGTACGGACTCGAACCCTCGTTGCGAGCTCCGCCAGACTTGGCAGGCGTAGCTGGTACCGTCGGCTGTCCTTTCGCCATG
TTTCTTGTTTTCTTGTTTTTCTTGTTCTTCTTTTCTTGGTAGCTCGTAAGCTGGAAGGCCACACAAACAGTTCACATTGGCCACACTCTGTTTCCGGGTC
GCCAGTTGTGGTGCCACGTGAACTCTAGCTACAAATGTAGTTAGGACGTTCCCACAACAATACGTCTGCTAGGATAGCAAACGATCGTTCGGGCGGATCT
GAAGACCCCAGTTCTGCCCTTGCACCGGGACAGACTGGACCTTGCAAACTACTTATGTAAGCCAACCAGTAAAAATAAGAACACGCTACTAGCACGAGCA
AAACTAATAGGTGTTTTGAATCCGCGTTGTCCCAACAGCGGAAGGGTACCAGGCACGGGTAAGCCTTTTACGAGGTCACCGAGTGTTCAGCACTCGGTTG
GAAGAATAAAAGGGGTGCAATACAAGCACTCTCAGTCGTGCAAATAGGCAACAATACGCCGTCACGTAAAACCTCCCGCTAGTAATCGGCCAATACAATA
ATAATTTTGAAATTATTATTCCTGAATTTTTTTTAACAACTATTTTATTAATTTTATTATTATTTGGAGTTTTTTATAAAAAAAATCAAAATATGCAAAA
AATTTTGATTATAAAAAATATTACTACTATAATAATATATTTATTATTAATTCTTTTAATATAACATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCTAAGCGAATATTCG
AGCTTATGGATCCCCGGGCCTAGATCGTGGTTCTGGCCGTAGGGTTGCCTTGCGGGTGTATTCCCTTGCCTTTGTGTTGTCCTTTAAGTCGTACTTGCCG
CCTCCTGTGACGGGATCTTGAGAGTTGAGACCTTCTTAGGTATGCCCGGCCAAGTAGTAAATCCGGTTAGCCTGTCGGATCTGCACGTGTAAAGGAAAAG
CTCACTAGGTTGTAGGATCTGGCCAATGTATTATCCAGTTATCGCTACCAACACTAGATTCGCAATTCCCAACCTTCTCGGAGCTCGTACGGCCAATGTA
GTTCCGGTTCTTGAGGGCAGGAAGGCACTTGCGTGTTATGGTGCAAATGAGGTTCTGTATTGGTATTTAAGCCTATACCTGCCTGGATTTCTACCTTCTA
TGTCTTTCATCTGCTAAATCCCTTACCAGGCTCGGCTGCATGTCCCTTCTTCCCTTGACCCATCATCCCAGCTGTATTATCTTCAGATCCACCGGATCCA
TGACGTAATCATCATGGTCACCCTATTATGGGTACACTCATCCGGATCCAGGTCGCTTGGATCCACTTCACTGTAATTGTACACTCGCCGTGGATCCGTG
CTCTCCAATCGCCCAACATCATCTTGCAACCGTCTGTGACCTCCATTATCCCACGAAAGTTCCAGATCCACTGCATCCCTCATCCCTGTACCCTGGATCC
AGGTCCTTCTATGCGGGATCCTCCCTCTTTGGATCCGAGCCCGGAAGTATGGGATCCGGGGTACCTCGCGGTGGATCCTGACTTCTCGTTAGCCGTGGTT
GCCAGATCCTCCTTCAGAGGGCGCCTACCATCATTCCTCCATAGGATCTACACTCGATCCGCCCGTCTATAGTATATCCCATATCCAACTAAGTGAATCC
GGGTAAGGGTGAATCCGAGATAGGGCTTGGTGGATCTTGCCTTCCCGTACATCACTCATACCAGATCCATCGTCATTCCATACGGGGTGCCGCTCGTCAT
GGCTAATCCACCACAGGCAACTTGCACCCGTGCCAAACAATTGAAATTGTCACTGATTCGGGATAGTGACCCCGCGTCAGGCCCATTCTCTTATTTCTGA
GAAAGCACTTCACCACACAAGATCCGGCGAAACAACGGTCACGCTGGATGGTTTGGATT