Description :
From Genome Similarity Track
Location :
contig_3:387148- 390661
Transcript NameFunction/comments
g995.t1XP_009522892.1 hypothetical protein PHYSODRAFT_328314 [Phytophthora sojae
g996.t1POM72845.1 Amino Acid/Auxin Permease (AAAP) Family [Phytophthora palmivora var. palmivora

Sequence
3513 bases(100 bases per row)
TGGTTTAGCTCACTTCCAATTCCACCTCCTCGGACGCAGTTCACTCGACCTCACTCACAGCTTCGCCACCTCTTACATACCTGATCACCATGGGGAAGGG
GCCTTTTCTCACCGGGGAGGACTTCAAGACGTGCTTCAACCTCTTCTGCTGCATATACGGCATTGGTACGCTTGGTATGCCCGGCAACTTCGCTCGTGCC
GGTCCGACGCTCGCATGCTTCGCCTTGGCCTTCATGGCCTTCGCCAACATCTACTCGTCCATCACCATGTCCAAGGTCATGCTGCTCGCTCCGCGGTCGG
TCAACACGTTCGGTGACCTCGGAGAATGGAGCATGGGGTCGCTAGGCCGCTGGCTGTGTGTCATCTCGCAGATGGGCTCCTGCTTGTTGCTGCCGTGCGT
GTTCCTGATCCTCGGCGGCCAATTGCTCGACGGACTCTTCCCGGATGCATGGAGCACCAACACCTGGACCATTTTCATGGCTCTCATGGTGCTGCCAGTG
TGCCTCGTGCCCACACTAAAGGAAGGCTCTGGTGCTGCCTTCGCTGGCTGCTTTGGAACGATCGTCGCCGACATCATCGGCGTATCCGTCGTCATGTACG
GCATGCGCGGACACCCAAGTGTACCGTTCCCCGACCTCAAGTTCCAGCAGGTGGCCAACATGTTTGGCAATTTGTCACTTGCCTATGGAGCCGGTATCAT
CATCCCGGACCTGCAGCGTCAACACAGCGACCCCACCCGCATGCCGCGCGTAGTCGGAGTGACCGTCGCCTTCGTGTCGGTCCTCTTTCTGACCCTTTCA
AGCACGTCGTACTCAGCCGTGGGGTGCCAGATCTCAGGCAACTGCTCTTCACCATCTACCCGGACGCCGACACGGGTCTGACGTCGCTCGGCTTCGCACC
CAAGTGGGGCGTCGTGGTCATGGCCTACCTGCTCATGCAGCTGCACATTACCATTGCCTTCTCGGTCATCCTGAACCCGGCCTTCTACATCGCCGAGCGC
ATGCTCCTGGGTATGCACAAGAAGAAGACGGAAGACATCGAGGACGGCTTCGGCTTCGACGAGTCCGCCACGCCTGAGTTGCAATCAAAGCAGTCAGAGT
CCGGGCTGATCCGCACCAACCACTCAGTTCCGGTCCTCCGCTCGAGCCGTCGATCCAAGATGTCGTACGTGTCTGTGGCAGACTCGGAGCGAGTGCACAA
GGACAACGAGGAGGAGGAGGCTGCCGAATACACCGGCTCCAACGCGCTCAAGTACGTCGCGCTTCGCATCACTATCGTGGTCATCTTGGTGGTTCTGGCC
ATCGTCTTCAAGGACCACTTCTCCGACTTCGCAGACTTTGTGGGCGCCTCGTGCCTCACAATGAACTGCATATTGCTGCCTATTATCTTCTACTTCAAGA
AGGCCTGGCAGCGTGTTCCGGTGTACGAGAAGATCGCTGGCAGCATCGTGGTCGTCGTGTGCTTCGTCCTTGGCTGCTACGTCTCGTACACCACCGGAAA
GGAGCTCTTCTTCCCGACCGACAACGACGCCGACTTCCCGTTCTGCGACTCCGAGTACGAGAACAAGGTCTACTACAACTACACGGCTGAGCACGAAACC
TAGGCAATAGTGCTTTGGTTGACACGTAGGTGACCACCGCCACGTTCGTACCATTGTCAATATATTACCCCCTTCTGTGCCTACTTTACTGGGGCTGCGC
AGCGATAGCGGCGGTCTACATGCTTGCAAGATCGGTATACATGTACACGGAGGAGCTGAAAAGTGCTTGGTCGTTCATGTTGAAGTGGCGATGCCTCGGT
TGCAGACCAGGCGATCTGCATCGGCGGAAAGGCAGGACTGAGGTCGGCATATTCATCTCGAATCGAGGTACATGTAGCTCCTTGAGAAGAACCTCATTTT
GAACTTAAGTTTATTGCAGACATGCCGCCCCCGAAGCCGCGCTTCATAGCAGCGGCCAGGTGGGGAGCTACGGAGCTACCGTGAGTCATAGCCTTCTTCA
AACTGTGAGCTTAAGCTTCGTGCTCCGCCGTGTAGTTGTAGAACACGGTGTTCTGGTACTCGGGCTCGCAGTATGGGAACATGGCATCTGAGTCTGACGG
AGCGAACAGGTTCTTGCCAGCCGTGTACGTTGAGTAACAGCCGAGCACAAAGCACACCACAAACACAATGATAGCGGCCACCTTCTCGGCCATCGGTACG
TTGTCCCACGCCTTGATCAAGTAGAACGCCACCGGCAGCAAGATGCAGCTCATCGTCAAGGACGAAGAGCCCACAAAGTCGGCAAAGTCCGAGAAGTGGT
CCTTGAAAAGAATGGACAGCACCACAAGGATCACCGTGATGCAGATGCGTAGCACAGCGTACTTGAAGGCGTTGGCGCCACGGTACTCAGCAGCCTCGTT
GTCGGTCTCACCATGACAGTTGCAGTGGCACTTGTTGTCGACAGCAGCCGGCGTCTTGACGATCTCGTCAGCGGGGGTTTCAGACTCGACGTACTGCAGT
CCGTGCTCAATGTCGTCCGACTTAGTCTTCTTGTGCATGCCCAGAACCACATACTCCGCCATGTAGAAGGCGGGGTTTAGCAGCACCGAGAACGCCGTCG
TAATGTGCAGCTGCATGGCGATGTACGCGAGCACAACGGCCCCCCAATTCGGCGAGAAGCCCAGCGATGTCAGACCGGTGCTCGAGTCCGGGTAGATCGT
GTATAGGATGTTGCCCGAGATCTGGCAGCCTGCAGACGTGAAGGGCACCACGGATAGCACGACGAACAAGGCTGAGATGATGACCATCGTGAACGTGATA
ACGCGGGGCATGCGGTGCGGCTCGCTGTGCTGGCGCTGCAGGTCCGGGATAATGATGCCGGCGCCGTAGCTGAGCGCGAGGTTGCCGAACGTGCCGGCCA
CCTGGGAGAAGCTGACGTCCGTCTGCGGGACACTCGAGTGGCCGCGCATGCCGTGCATCACGACTGCCACGCCGATCACGTCAGCTACGAGAGTACCCAC
GCAACCCGCGAACGCGACACCAGAACCTTCCTTCAGCGTCGGCACGAGACACAGCGGCAGCACCATCGCAGCCATCAGGATGATCCACACCGTCGGGTCG
AACGCGTTGGGGAAGAGTCCATCCAGCAGCCCACCGCCGAGAACCAGGAACACACACGGAATGAGGACGCACGACGCCATCTGTGAGACCACGCACAGCC
AGCGACCGGTCTTGCCCATGGCCCATTCACCGAGGTCGCCGAACGTCACGACGGACGTAGGCGCGAGCAGCATGACCTTGGACATCGCGATCGACGCGTA
CACGTTGGCGAACACCATGAAGATCATGGCGATGCTGGCATACACGGGGCCGGCACGGGCGAAGTTACCCGGCAGACCCAGCGTTCCGATGCCGAAGACA
CAGCAGAAGAGGTTGAAGGAGATTTTGAGATCTTCGAGCGTGAAGAGCGATTCCTTCGCCATGGTGAAGCCGATGGAGTGGCGCTCGGTTTGACTCGAAG
AGTAAAAAGCAAA