Description :
From Genome Similarity Track
Location :
Scaffold_528:3871- 7070
Sequence
3199 bases(100 bases per row)
ACGTGCTGACCTTTGTAGACGACTACTCAAGGTATGTCGTGACATTCTTCAAGAAGAGCAAGAGTGAGGTGGGCAGCAAGCTGAAGGAGTTCAAGGCGCT
GTATGGAAATCAGTGGGGGGAACGATTGAAGTGCCTGCGTTCCGATAATGGAGCGGAGTTTGTAAACAAGACGGTATTGGAACTCTGTCAGCGGAATGGC
ATCGCGCATCAACGCAGCGTTCCATACAGCCCTCAGCAGAACGGTGTTGCGAAACGCATGAACCGTACCATCATGAAGATGGCACGAAGCATGCTACACT
ACAAGTCTATGTCGACGGAGTGGTGGGCTGAAGCGGTGAGTACTGCAGTTTACCTTATCAACCGTTCCACGAACACATCCAACTCGGATGTCACGCCATA
TGAGTTGGCGTTCCGAGTGAAGCCACGGATGGAACACCTACGCGTGTTTGGATCACAAGGGTACGCTCACGTGGCTGATGTGAAGAGAACGAAATTGGAA
CCCAAGAGCTTCAGGTGCACGTTCCTCGGATACGCAGAGAACGTAAAAGGGTATCGTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACATATTGGAAACCACTACTCCCACTCGAATACAGCATACAACAGACCATATCAACGGATATCAA
ATCCCTCACATGGCACGCTCAGGATGCGTCAAAGAGAAAAGGATGAGGAGAATCCGGAAGACACCCCTCCACGCCTCTGAGGTGGGACGCTGTTGAACCG
AACCGGAACGCCCGGGCTTACCACAAGCTTCCCCGCCCCGGATGAACCGCGCTTCGAGTGAGACCGGAGGCTGCCACGTTCCGTCTCACCAACGTACTTA
CAGTCCAAAGAAGCCCGGATAATCCTCTCCATCCTGAAACGGAACTGCTCACCCCGACTCCGTGAGCTCGGTGTTTCTGCTTGGGGAACGGCCACGATGT
CGATGTGGAACGCCAGTCTGAAAGAGGTAGTGATGGGCCCGCCGTCTCCTAAAGCGTCCTAGGATCGATGAAGACTGTTTACTCGCAGAGGCAGTGTTTG
GCATACGCGGGCCAGCATCGGAGGCGTTTCGGATACGCCGAACACGTACGCAGAAGCTATCGCCAGTGATGAAGCAGCTGAATGGCGTCGGGCTATGAAG
GCTGAGTTACACTCTCATTCCCAGAACGGAACGTGGACGTTGGTTCCATGTGGAACGGCTACGCGTTCCATTGGATGTCGCTGGGTGTTTACCAAGAAGC
GTGACGAGAACGGTCGTGTTATCCGTTACAAGGCACGCCTAGTAGCTCAAAGGTTCAAGCAGAAGTTTGGAATCGATTTTTTTGAGACGTATTCTCCTGT
TGCAAACATGAACTCGATTCGAGTTGTACTCGCTGTGTGTGTGGCATGCGACTACATTATGGAGCAACTGGATGCTGACACAGCGTTCCTAAACAGTGGT
TTGGTGGATTTGGTCTACATGGACGTTCCACTAGGTCTCGAGAACGCTGAACGCATGAAGTGCAAGCTGCTAAAGGCCATATATGGTTTGAAGCAAGCTG
CAAGTGCATGGAACAAGACTATCCATCGTGTGTTCCTGCGGAGCGGTTTCAAGAGTTGTGGAGCCGACCAGTGTGTCTACGTCAAGCGTTCCAGGGACGC
ATTCGTGTACGTGTGCCTGTATGTGGACGACATGATCATTGCGGCGAAGACACGCGAAGAGATTCGCGAAGTAAAGGGCGCTCTGAAGAGTGCCTTCAAG
ATGAAAGAGCTTGGCGAGGCAAAGTTCATCCTGGGGATGGAGATTGATCATGATAAGGCAGCTGGAACGCTGATGATCAAGCAAACTCGGTACATTGACG
ACATTGTAGAACGCTTCAACCAACGGAACGCCAAGATGTTGGATAACCCATGCGCGTCAAACATGAAGCTGTCGAAGATGATGTCGCCAGCCACGGAGAA
GGAACGACGTGAAATGCAGTCAAGACCGTACCGTTCCTTGATCGGATGCCTGATGTACATCACAACATGCACTCGACCGGACATTGCGTACGTTGTAACG
CAGTCGTCACGCTTCCTGGAGAATCCTGGAACGCAACACTGGAAGGCAGCGATACGGGTCCTCCAGTACTTGAAGACAACTCGGCAGCACGGTATCGTCT
ACCAAAGTGGAACGCAAGGTGTCAAGGCAGAGGCGTTCACGGACGCAGACTGGGGAAGCAACATTGACGACAGGCGTTCTGTATCAGGTGTCATGGTCAT
GATTGGGAACGCTCCGGTTGTGTTCAAGTCCAAGTACCAGAGAACGGTTGCACTCAGCTCAGCGGAAGCAGAGTACATGGCTCTGAGTCTGTGTACGCAA
GAGGTACTGTGGACACGTGCTATTCTCAAGGACATGGGTCACGAGCAAGTGGGAGCGACGCAGGTCTGGGAGGACAATCAAGGTGCTATCGAACTTGCAA
GTAACGCTGGGTATCACGCTAGGACCAAGCACGTGGATATCCGACATCACTTCATTCGGGAGAATGTGGAACGCTCTAGGATCAAGGTGGACTACGTCGA
CACGAAGCGCCAACATGCTGACGAAGACGCTTGGAACGAAGACGCTAGCGTTCCTTCGCGAGGCAAGCGGGATCAAGAAGAGGAACGCCGCTGAGTAGCG
ATCCTTGACGAAGACGAACGCCGTGCAGTAGCGGTGAGTGGGAGTGTTAATTCACACCGACTCTGCACGGTTCCGCTAACCGGCTGAACGTTCCAGGATG
GGCCGTTGCCAAACCGGTTAATCTGGTGGATGGCCAGAAGCGCTTGGCAAGAGGACAAAAAGGAGGTAAACGCTAGAGTAGAAGTTTAGAGGACAGATT