Description :
From Genome Similarity Track
Location :
contig_24:38707- 40697
Transcript NameFunction/comments
g4500.t1hypothetical protein

Sequence
1990 bases(100 bases per row)
CTTGACCAAGCTCGTGCACCTGCATGAGCCCGCGATTCTGCAGGTGCTGCGTCGTCGTTTCTTCCACGGAGAGATCTACACCAGCACAGGGCAGATTCTG
GTCGCCATGAACCCGTTCAGACGTCTGTCGCTGTATTCAGACGACATCAAGGACCGGTACTATAACCTGGGAGGAGACGCCGAGGCGGACAAGAGCATCC
TGGCGCCGCACGTGTATTCAGTGGCGGACCAGGCGTTTCGCACGATGCTCGTGCCGCAATCGAGCGACAAAAAGACGAACCAGACGATTCTCGTGAGTGG
CGAGAGTGGCGCCGGTAAGACGGAGACCACCAAGCTCATTATGAACTACTTGGCCTACGTGTCGACGAAGCGCACGCGCCGCCCGATTCGAGAAAGCAAC
TGTGACCAAACGACGATTCACGACCGAGTGCTTGAGTCCAACCCGATCCTAGAGGCGTTCGGAAATGCCAGGACGACGAGGAATAACAACTCCAGTCGCT
TCGGGAAATTCATTAAGCTGGGTTTCACGTCTTCAGGTGAGATGCTGGGCGCTTCTATCTCGACGTACCTGTTGGAGCGCGTGCGTCTTGTATCACAGGG
CAAGGGTGAACGTAACTATCATATTTTCTACGAAATGCTCGGTGGGAGCTCCCCATCGGAACGTCAAGAACTGGCGCTGCAGGACGTGCATGGCTACGCT
TATTTAAATCAGTCCGAGTGCTATGAGCGCCTGGACGGCGTGGATGATGCTGAGTCCTATCAGGTGACCCGGCGAGCCATGTCAAGTATCGGAATGAACC
CTGATGAACAGGTCAATGTGATGAAGATCGTGTCGGCCGTACTGCATTTGGGAAATGTAGTTTCACGACTGCCACGCGCAATGGCGGGAAGGATGATGCC
TCTGTCGTTGACATGGATGCATGCGGCGACAACATTAAAGCTATTTGCTTACTTCTCGGTGTAGAGGAAGACGTGCTACGGAGTACGTTATGTACGAAGC
AGATTAAGGCTGGTGCCGAGTCCATCACGACTCGTCTGCCAGTAGCGCAGGCACTTTCGACGCGAGACTCTGTGGTGAAGACTCTCTACTCAAACCTATT
TAACTGGCTTGTGGACCGCATCAACCGGAGCATCGAGTACAAGGAAGAAGCGGGCGGCAGTCAGTTTATTGGTGTCGTTGATATTTTCGGCTTCGAGATT
TTTGAGCAGAACCGTCTCGAGCAGTTGTGTATCAACTATGCCAACGAGAAACTGCAGCAGCTCTTTGGTAGGTTTGTGTTCCGTATGGAGCAGGACCAGT
ACGTTGCTGAAGAAATTCCCTGGAAATTTGTGGACTATCCGAACAATGACGTGTGTGTAGCCCTTGTGGAAAAACGACACATGGGCATCTTCTCTCTGTT
GGACGAACAATGCCTAATCCCGCGTGGTAACGATGAGAAGCTGGCTAACAAGTACTACGAATGTCTTGCCGGCAAGCACGAAAGTTTCTCCGTGACCAAA
CTCCAGCGTGCGAAGGGTCAGTTTGTGATTCACCACTATGCCGGCGATGTGTGCTACATGACTGATGGCTTTTGCGACAAGAACAAGGACCACATGCATA
CAGAAGCGGTGGATCTGCTTCGTACCTCCAAGTTTTCCTTCGTTCGTGCTTGCTTTGCAAACAGCGTCAATACGACCGGAAACGGCAGCCCCAGGAACGG
TCGGACTGAGTCACGTGGAAGTGACTCCACTCGACGACGCTCCGGGGGTATGTTGTCTTCAACGGTTGTAGCACAGTTCAAGAGCCAGCTAAGCTCATTA
CTGGATGTTTTGAATGGGACGGAGCCCCACTTTATTCGTTGCATCAAGCCAAACGACCAGGCGAGTGCGTCGCAGTTTGAACGGCGGCGTCTTCTTGAAC
AGCTTCGTTGCAGTGGTGTACTGGAAGCAGTCAAGATTTCACGCAGTGGCTATCCTGTGCGTTTCCCTCATGAGGTATTTATCAAAACGT