Description :
From Genome Similarity Track
Location :
scaffold_209:38697- 43439
Transcript NameFunction/comments
Pl_107678conserved hypothetical protein
Pl_107681hypothetical protein PHYSODRAFT_284177

Sequence
4742 bases(100 bases per row)
TCGTACTTACGCGAGTACTCGCGCCACATGAACCTCGACGTGTGCTCCGATCCAGCCGAAGCAGTTAGCGAAAAGCCAAGAAGAAACGGCAGCTCCGACT
GAAGACGCACCAGTCATCTATCTCTAGCGCCTCGTTCTCAGTCCGACATCCAAGTTACTGACACCATGAGTCCCGTCAAGGTGCGTGGTGTCTCCTCTCC
ATCTTACACTCTTGTCTCCTATTGACGTCTGTCCATCCCAGACATGCGTCGTGCTGACCTCGTCAATGGTTTCAATCGCTGAGCAAAAGTACGAGATCGG
CCACCTCAAGCAACTGTTGGATGGCAACAAGATCATCTACACGGAAGTGGACTGCAGCCTCGAAGAAAACCGCGACACACGCAACCACTACTTCGAGGTC
AGTGGCATCCGGGCCAACTACCCACAAGTGTTCCTGCAAGACCCGGAGGGAAAATGTATCAAGTACATTGGCTCTTTCAAGCAGATTCAGGTACGTGACA
CGACAGGCCGTCGCTGAATGATACTGGACTGACCACTGACGTGCTTTGCTTTAGGAACTCAACGAGATGAACGACGTGCCACCCGAGATCCTCAAGGCCA
ACGACATCCCGACGCTCAACACTGTCTTTGCCGGTACGATATCATCCACTAGAGGAAGCTGCTTGATGTTCGCCGCTCATTCTTCTCGTGATTGTGTTGT
GGTATTGCTGCTAGACGTTTCGAGACGAGCTTGAAGCAAGCTCTCGACTGCGGAGTCGATCGAACCCATGAGGATGACAGTGAAGGAAGAGGCGCCACAT
GCGCTTGTTGGTTGTCTCGCCGCGCAGAGCTGTCTTCTCGACTCTGCTTCGCCTTAGAGCCACACGTTGGCAAGCCGCTACACAAGTTTTTATTCAAGAG
CCATCCAACGCGCCACCGACTACATGTACTAAGAAGCCAATAGATCAACTCAACCATACTTTTTTTCGTGCCGCCGCGAGCACCGCGCTGTTGTGTTGCT
AACTTCGCCCATGCGCACGTGTTAGTAATGTTGAGGAAATATGCAAGCATGGACGACGCCGCGGCGTAGTGACACCTGTACGTTCTTGAGCCGACACGCG
TTCACCCAGTCACATGAAAAGGTATCTATTCTGTCGAAAGTGGCGACTACCAAGGCATTGCACACATGCTAGTTTCTCCGAGTAATATTTGCTAGCTTTA
TGATACAACGATGCTCTACTGCTACTCAACAAGGAGAAGGACACTCTCCTTCAGCTACGAGCTACCTTCTTGGGTCTCTGCCCGTTTGTCAGTCCGATAA
TCGGTTGTGCTCTTCGTGAGCTCTCCGCCGTCTTGCAATGTCTGAAAGCCTAAGCCGTCACCATCAGGCACCGCAGAACGTCAGCGGCCTTCTTAGGGTC
CTCTGCGAACCGCTCCAGCGCCTTCTCGCCAATGCGAGACAGGTTCAGCTGGCGAATCTCCTCCACGATCTTGCCTTCCTCGAACGTAATGTGCGAGGCC
ATCATGAATGACAACGGCTCGTTGCTATCACTGAAGTGAGGCGCCAGGTCCGCGAACGGAGCAGTCAGAGGCACGTTCTTAGCCGCCTCCTTCTTGATGC
TCACTTCGACCTCCCAGTTCACAAGGCACTTATCCGTAGAGTTGGGCTTCCACTGCACCGTGTACTGCTTGATCTCGTACTTGGCAAACACACTAGCACT
AGACTTTTTGCTGGCAACGATATCCGTTAAGCCAGCCACACGAACACCAGACGTGCCGTACAGAATCTCAGCGTTGTCAGCCCAAATACCACTAGCACTT
GTCTCGAAGGCGGAACCGTCAGCTTCATTGTATGCGCGTACGTACGATGATAGCGTCGTGTTCTGCTTCTTGCGGAGATCGTTCATCTGAGCCTCAGTCA
ATGGTTCCTCCTTCATACCCGAGTCTTTGCGAGCCATTTTAGCCTTCAGCATTCCATTTTCCTTTTCCAGCTCAGCAGTTCGATCCTCGAGGAAGTTCAG
ACGATCTTGTTTTCGCTTGCGGCACTTGCGCACACGCTCGCGGTTCTTCATACGGCGACGCTCATCTAAGTCTTCTTGGTCTGAAACACGATCCGAGTTT
GGGGTCACACTAAGACGAGGGTCGGTGGGCTGCTGTAATGCGGGGCGGTTCATGTAGTCGTACATGGGCATGTTCATGTTGGCCATCCCCGGGTGTGGCA
TCTGTCCATGGTGCGGTGGACCGTGGTTCATTTGCTGGGTTTGGTGGTGAATCTGCTGCATCTGCTGGATGTGCGACTGCGGCGGGGCTTGCGGCTCCTG
CTTGTACTGCTCAGCCATAGACATCTTGGGTGGGCTGTTGTTTGAAAAGGCACCGGGGAAACGCATGGGAACTTTTGCTCCGGAGACGTCCTTGGGTGTG
AAGCCAGAGGGCGAAATCTTGTTGTTGTTGGCGTCCGCGGCACTGCGCGGTGAATAACCGGCTCCAGGTCGGTTCATGTAGGCACTGGGGGTGTCCGTAG
GTGGTGCGTTGGGTGCTTGACTCAGGCCCGTGACGTTGATGCGAGGAGTGAACCCAGTCGTAAATCGAGGCGTGAAGCCTGAGCGAGGGGTCAATCCCGT
GCTGAAGACACGAGGCGTAAGGCCCGTCTTGAAGGTGCCGACAGGGCCGCAGAAGTCGCGCAGGTCTTCCATGCCGAAGGTGCGAGGGCTGAGGCTGATG
GGCTTGGGTAGTCCAGCGATCTGCTGTCCAACGTCGCCGCTGAGGTAGCCCGTGGAAGTGGAGAGACCCATGCCGTGGCTTCCAGCCACGTTGGGCAAGC
CAAGCTCCTCGCGCGCCGAGTGGAGGCCCATGGACATGGCCGTGCTGGAACTGGTCGGGAGAGTCTGGGCGGGAGGAGCTGCTGCGCTCGGTCTGTGCGA
GTGCGAACTAATTTTGATCCGAGGGCGGCGAGAACGAGCTGCCGCGGGGGGACTGAGGCTCTAGTGAGAGAGAACGCTGCGTGTCAAGCTCGGATCTTTC
GCCACGAGCGTAGCAGGTCTGCGAGGTCGTGCACGCGGGTCGGTGTCTGCGTGTTCGGGACGCAGCACGTTACACGTAGCGGGCAAAAGAGATTATGTAA
TGATGGGGAGGCTGTGCTCTGCGCTCGCTCTGCTGCCTTCGCTCTTCAGCTCGGCTGGTTGGTCCGTCGTTGTGAAGTTGCAACTCCGTTCAAGACTGGC
GGGAGAGCACTGGTTATCGAATTCCATGTGCCAGCCTGTCGCAGTGCCTAGTTAGGGAGAGAGTTTCAGCGCGGCTCGGCTGTTTCTGGGCATCTGGGTT
AAAGAGCCGGACCGCCACTTGAGCGGCAACCTCGCTCCGGCGAGCGCTCGGCGGCGCTGACCCGCGCGCTAGCTGGCGACGAGCGTCAACGCAAGACGCC
TCAAGCTCGCAGAGTAGTAATACATGTAGAGCTAGGCAGCGCTGCAGCTCCGCATCGAGGCGCGCGAGCTCGCTCGACGCACTGCGCACCAGATGTCCTT
TGCGCAGTATCTTTCGGAGCTGGCGTGCCACTGCCGATTGTCCAGCAGGGACTAGTAGCAGCTACCGGGCTCTGCGGCCTGCAATTGTGCGGGCAAGGCT
GTGCCGGTTGTTGCACCCTTCTCGGGCGCCAGCAGGGGCGACGATAGTGGTTCGCGAGGAGTGGTGGCCGCGCCGCACCGGCAGCTGGTAGGCGGGCGAA
AAAGTTAGTGCAAGTTGGCAAGCCAGCGCTTTCGAGCTTTCGAGCTCTCGAGCTGCGCGTTTGGACGAAAGCGGCCAGCGGCTAAGGCTGGCAATCACGA
CGCGATCTTTCTTTGTTGAAGAGCATCACGGTGGTGACCACCGCGGTGAGCACAGGTGGAGGTCAGGCGAGGAAAATCCACCCTCGGTTTGCAGCTTGCA
TGCGCACCAGTCAGCTGTATTGCTCTGCTCCGAGTTGCTCGCCGTCTCTTGCAGCGTACGGAGACCGCCGTGGTACAATGCCGCTGTCACGTTGATGCAA
GTCTTGCAGCAAGACCAGCAAGATGTAGGACACGACGATAATATCCGTTTTCATTCGGAGCTCACCTGCAGACTTGCAAGATCGCGCTCTCTCGACGTCA
TGTTGCTGCGTGTGGCAAAAGCTCACCATGACTTGGACCGCGAGTGCGATCAAGTTTGCTGAACGTTCCGTCGGGTACAGGTGAGTGACAGAACTAACGG
CTACTGTCAGTCGAAAGATACCGGGGTAACCGCTCGTGATAACAAGTAGCCATGTCTGCAATGCGTGAGCAAACGCGACTGCCTCGTGAGTGGACTTCGC
ACACGAGTAGAGCAATTTCTTTGGTGTTCACGCGGGGCGGACCACAAGCCGATCGCTGGACAAGTCACTGATCCATTACTCGCGTGCCAGCTCACCACGA
AACAGCACGTAAGTAATACACCGTTAGCACGTGGTTGACGGTTGCCGCGAAAGCGGTGAGTCTCCATACTTGCTTTCTTATTTGCCCACACGGTTTCGGG
GCTGATTTCGGTGCATAATAAATAGCAAGGCGTTTAGGTGGAGCTGCGCGCTTGACGTACTCGATCAGAAGTTCCGTTTTGGCCACTGTGTCGCTGTCGA
TGAGGACAGTCCGCTTGTCGTATGGCATGTATCAGCCTGCACATTGACGGCAAATGACGAGGCTGTCCTCGCAGCGAATGGCTGCTGCAACTTGCGTCCA
GTAAACCCCACGTCAAGTCGCCAGTAGGGCTTCATTTCGCCT