Description :
From Genome Similarity Track
Location :
Scaffold_66:386837- 388129
Sequence
1292 bases(100 bases per row)
GCCTCGCCAGTCGATCCAGGGCTCGTGCTTCTCAAGCCAGGGCATGCCCAGGATCATATCATATGGATCCATATCGAGAACAGTGAACTGTTCGAGGCTG
TCAAAGTCTTCAAACTTGACAGCCAGATCCACTTGGACGTTGGGGACAGTGACGACCTTCCCGTCGGCCAGTCGCACTGACACCGTCCCGTTGCCCTTGC
TTTCTCGCAAAGCTTCGGACAACTTGTTGCTGCTACGAGCAACCGTCTGGCGGCGTGCGAAATTCTTCGACGCCCCAGAGTCAATCAAGATTCTAAAGGG
GTGATCGTACCCCCGTACACATCCGTGTACTACGAGCAACCCGCCGCTGCCCTTCGCCGATTCGAGAGTGCGAAGACTCTCAGGGGCTAAGTCCCCGTGG
TACACGCCACCCGCGCACCCATCACGAAGACTTAGTTCTTCCCCAGTAGGGCGCCCCGCCCCTACTGGTTCCCTGCGTTCCCCTGTCCCCGGGATCCTGG
CTTCTGCCAGCGACCCTTGAGGACGGGCTTGGGGAAGGACCGTCTGCGGAGTCTTTCCGCGGGACAGTCGCGCTTGAAGTGGCCCATCTTCCCACAGCCG
AAGCAGCGGATGTCACGCTGTTCGGCGGACCCGAGTTCCATGGGAACTGGTCCGTTGGGGCTTGTTCGACCGGGAGCCGACAAGGAACTCCCAGGCCACG
CTGAGGTCGGCGTACGCGCCTGGCGATGGCTGTATTCTTCTTGAAGAGCCACTTGAATCGCCTCTTCAAGGGTGTTTGCCTGCACCCGGAACAGCCGAGT
GCGTGCGGGGCCCACTCGAAGGCCGTCCATGAACACAGTCATCTTGATGTGTTCATTGAGTGGGTTTCCCACTAGGGACGCCGTGAGCTCCCGTATCTCT
TGCACATACTCGTGCAGTTCGCGTCTTCCTTGTTTACACGCGAGGAAGCGCGAACGCTGGCGGTACTCGTAGTTCGCCGGGAGGAACGCGGCTCGGAGCT
GTTCGCACAGCTGAGCCCAGGATGTGAAACATCCAGGGGATGTCGCTTCCCGAGTGTACACCCAACTCTTAGCACGACCGCTAAGATGGAGAGTGCAAAA
GCAACACGCAGTTGCTCGGTCGAGATCAGAGCCGCGTCCATCGCGAGCTCTACTTCTCGGACCCAGAAGTGAAGGTTCTCGCCTTCCTTCCCTTCATACG
GCTTTACCTTCAGCCGTATTGGCTTCGGGTGAGGCGGGTTTGCTTCCGCCGCCGGAGCCTGCAGGTTCTCCCGCACATGCGCGATGAGGCCC