Description :
From Genome Similarity Track
Location :
contig_97:38681- 40471
Sequence
1790 bases(100 bases per row)
AGCGCATAATTAATTATGCATGGTGCAACAATTGCATTGGTCCTTGTTGGATTGCATTCTCCAACACAAATGCATTCATTAAATGAATGTACAATGTTGA
GACGGCGGTGGAATGCTGGAACAGCAATGATAAAATCGTGCATCATTCTTTGGCTATGAATGGCTGTTAGGGAGCGATCACTCACTGCGTAAGGAAACCC
CACCCACGAGCTGGAACCCAGCCAATATCCAGTCTGGGCGAGTTGCACGACTCGGAACAGATTCATAAGTATCGAGTCTTGTACCTAGAGACGTGGAAGC
AGGGTGCCGACGAGATGATTGACCGCATGGAAAAAACTCTGGAGAAGAGCGTGCTTCGTGAATTTGCTGATCAGCAACAACGTGCAATGACTGGCGTGCT
GAGAAGTACAACGCACTGGGTGAAAGTTACGCAGAAATGCATGCCAAGTACTTAGAGATGTATGAACTACCAGCACGATTAACCAAGACACAGCATAGTC
TCATGGTTCTTCAAGCCGAAAAGAGTGCAAGAAGTGGTGCAGGAAATACAAGTGGGGAAACCGGTTGCGATTCAGATATCCCCCACGACCGGATAGATCA
ACTTGAGAACGAGCTACAGGCGCAAACGGAGCGCGTGAAGACGCTTGAAGTAGCTGATCGAAAGGCTGTAGTCGATTCTGACGAGTTAGTGCAGTTGCCA
CCGCTCAGAGGACGTTCTGGAGATGACAATGAGCTTCGAAATGAGAACGCGCTGTTGTACGAGAGAATTAGCGAGGTGGGGCAGCTAGAGCAGCAGGAGG
AACGACTTCGTGATTTGATGGCTTCCTCAGAAGATCACGCAATTGTAGGCGAGCTCCAGCATCAATTGATGCAGATCAAGACGACCTACCAGCAATTCCT
TGTGCAGTACGACCTAGTAACGGAGACGCAACAACAAATACTCCTGAAAAATCAGCGACTTGAGCTGGAGATGGAGAAAAAGGCCCAGGAGCTATCTACA
GTTCGTGAAAAGTCAAGCGATAAAGTCCAAATTCTCGAGAATGCGATCGGGCAAGTGAAAGAGCGTGACTGGACCGCGCGAAACACGAAGTGGGAGGCTT
TCCGGAAGCGTTTAGATTCATTGGAAGACGAGATATTGGTCGAACAGCAGCGCCGAAAGCAACTGGAGAAAGATTTGGAAGACAAGCAGACTCAACTACC
GCTACTTGAGCTTAAGCAGCAACGTGGCAATCAAAGCGAGGTTGGCCGGCTAAAGAGCCGGGTAGACGCGCTGGAAACTCGTGAGCGCTTACTCATGGGT
CAGCTTGAGGCGGCGACAAAGGCGTCAGGGCCCAGGGAGAAGGAAACCCGGCTGCAAACAGAACTTCGTGAAGCGAAAACGCTTAATGAAGACCTACTGC
GCCAGCTGGAGACAATTCAAGCTCGTGTATCGGAACTGCTGCGTCTAAATGGCGAGCTCGAATCGGGAAAACGTGAGCTACGATGTGAATATGAGGACCT
GGAGCTGGAACTACAATACGTTCGTTCGGGTCTCACGGATGGAGAGGCGAGAGCACGATAAGAAAGAGCGCGCGAGTATCCATTAGGGCTAGGTGATGAG
TGCATCGTGGTACTGCCCAAATATTATTTTGGTGTTTGGCTCGGAAAGTCAAATGTCGGGCAACTTGGCCTCCAGTGGAGCGCGAATTGCCCACTTTCCG
ACTTTCCGGGCCATTTAAACAGCAACGTGGAGGATCGGAGGTCTGCCGACATGATTATGCGTCGGATTATGCCGCGGTTACCTATCGGTT