Description :
From Genome Similarity Track
Location :
Scaffold_277:38671- 41573
Sequence
2902 bases(100 bases per row)
TCGATGGCGTGACAGGTCAAGTGAATGTTGAAGTTGGACTTGCGGCCCTTCCATCCTTAATTGCTCTGTTAGAGCTAGACGAAATGTTTGTAGACGAGAT
AGGCCAGGTCTTGAAGACAGACGACTTATCCGATATGGTGGTCCTTAGACCCGATAATGAGTTGAGCTCCTCGTCTCTATTATATGAGATGGTCCTTGAA
AGTAGAAAGGCGGCACTTAGTGCATGAAGTGGATCACCTACTTTGAAGAATCTTTCAGACCCCTACTACCCTTTGGTTAGGGAAATTCAAGACGGGATAA
GTCACAATCCACCGTCTGTATTACCTCCCGAAAGGGGCGTACGTCATGAAATCGACTTGGTTCCTGGAACCAAATCTTGTGTTACAAGGCAGTGGCCTTT
ACTAAAGGAACAATGTGACGTCATTGACGAGCTTTCCAGTGATAAGCACGCAGCGGGAAGGGTGCGGGAGATTAAGTATCCTCATTCCACACCGACATTT
TGTGTCAAAAAATTAATGTTAAGTGGCGTATTGTGCACGCTAATGATAAGCTTAATGCGGCCACTATACCGGCACGAACAACCATTCCTAAAAAGGAAGT
TCTTGAGAAGAACATGGCAGGAAGTACAATGTACAGTGCACTCGAACTGGTCGATGAATATTATAAACTGCTCATGCCAGCAAGTGATATCCCGCTTACA
GCCATTAGTTCTTCAAGCGGTATACTTTGGGAGTGGCTGGTTATGCCCCAGGGACTTTCCAATGCCTCGGATACGTTTAATCGTCTGGTGACGCAATTGT
TCCGCCCTCACCGTGCGTATGCACAAACATATTTCGATGACATATTTGTCCATAATCGGGCGGAACAGGGTCGATCGGACGTGTATATCTACATCGACCA
TTTACGAGCGGTGCTTGAGTGCATATGCACTAATAAGGTTTATGCTAATGCATCAAAATGTATCGTTAGTGCGGATGAGATACCATTTTTGGGATGCTTC
ATTGGGAAGCAAGGCCTTCGAGCAGATCCTGCAAAGGTGAAGGCCATATTGGATTGGCCATTTCCTAAGAATCAAACCCTACGCAAATGGCTTGGCATTG
CCAATTACTTGCACAAGTATAGCGAGAATTACGCTGGTATGGCTCGGCCATTATCCAATCTCCTTAAAAAGGATGTGGAGTGGTGCTGGACTAGCACCGA
ACATGAGGCTCTTAAGGCCGTAAAGGAGAGTCTCCTACATGCCCCAATTTTGGCTTTGCCAGATTGTGATCGGCCTTTCAGTGTCGCCTGTGGCGCTTCG
ACCTTGTCATTTGCTGTGTTCTGTTTCAAACAGATGTTGAGAGACGCAAGCTTGTCATCGCTTTTGAATCCCGTCAGCTTAAAGCTGCTGAAAGAACTAT
CCATTTCACGACAAGGAGCTACCTGCTATGAAGTATGCTATAGTCAAATTCAGAGTTCATCTGCTTGGCTCTAAGCCTTTTGTTGTCTATACCGATCATG
CGTATTTACGCACGGTGACCCAATCGCCTCACCTCTCGAAGAGGATGGCCCGTTGGCTTTCATTCTTTGCAGAATATAACTTTGAGGTGAAGTATAAGCC
GAGAAGGCAAAATAATTTGGCTGATGCGTTCTCACGCCGGCCTGACTATGAGCTTGCTCATGTTACGATTTTGTCGTCGTCAGTTACTGACTTAATCCTT
GCATCTTATGCCAAGGATGAACAATGTGTCGCTTTGCTACGTGCTCTTGGAAGCGATGAGTTTAAGGACTCGTACATCAACTTGTCGGCGCGTTCTCGTC
CGAGGCTACATCGATATTCCTTCGATAACGTCTTGTTGTGCTATCGCCCAAATACTGCGGATACCCCACGTATCGTTGTTTTTCATGATAAGGAACTGAA
GTATTGCATCCTCTATGAGGTCCACGACACGGCGAATAGAGGTCATCTCGGTCGTGAGAAGACCTACGGCTTAATTAGTCAGAGTTATTGGTGGCCGAAA
CTCTATAAATGGGTTAGCACTTATGTGCGCACATGTGAGACGTGCCAACGGGTCAAAACCTCTGGGTGTTGGGAGTTTATCAGAATGAACTTTGTGTTTG
GCCTACCAAAAGATTCGGGATGACAACACAGGTATAGTGGTCTTTGTCGACCGTTTGAGCAAAATGGCTCTTTTAGCAGCTGTGCCGGATTCGATTGATG
ATGAAGGTACAGCTTTGCTGTTCATTGATCGCGTGTTTCGCCAACACAGACTGCCACTGTCAATTGTCTCTGACCGCGATCCTCGTTTTACGGGCAAGTT
TTGGAAGGCCATCTTCAAGGTGCTCGGTACCAGATTAGACATGTCTGCCGCGGATCATCCCCAGAACGATGGTCAGACTGAGCGTGTCAATCGCGTCATT
AATGACATTTTGCGCAGTGTTTGCGCTGATACGCCTATGCGTTGAAGCTCCATGCTCCCCGTTTTTGAGTTCGCTATGAACAATGCCGTCCATGCCTCGA
CAGGCTACTCCGTTATACGTGAACGGCCTCACACATCCCCGCGTTCCGTTAACGCTACCACTACGTGGCTCAGGACTCGGTGGGGGAGAGGTGGTCGATC
GGTCTGCTGATGTCAGCCCTGCTACTGTTCAAAAACAGGTTAGCGCGTTCCTAACAACGCGATTTAATGTCTTACGACATGTGCGTGACGCAATGAGTGG
TAGCCAAGACAAACAGAAGGAACTAGCGGATGCTAAAGGCATAATCTGTATTGAAAGTTATGAGGTCGATGACCAAGTCGTACTAAACGCTAATAACCTA
CCTACCATGTAGTGTCTGCTGTGTTTAATACTAAGCTGCGTCCTCGCTCATCGAACATTTACGGTCGTGACAATAAGGTCTTGCATATACGCTCAACTTA
CC