Description :
From Genome Similarity Track
Location :
contig_97:38668- 40458
Transcript NameFunction/comments
g12833.t1XP_009523320.1 hypothetical protein PHYSODRAFT_259378 [Phytophthora sojae

Sequence
1790 bases(100 bases per row)
AACTCTTAGAGCAGGTATAGCCATTCGAGCCTGTGGTTTCAGCGTCCTCACAGCGCATAATTAATTATGCATGGTGCAACAATTGCATTGGTCCTTGTTG
GATTGCATTCTCCAACACAAATGCATTCATTAAATGAATGTACAATGTTGAGACGGCGGTGGAATGCTGGAACAGCAATGATAAAATCGTGCATCATTCT
TTGGCTATGAATGGCTGTTAGGGAGCGATCACTCACTGCGTAAGGAAACCCCACCCACGAGCTGGAACCCAGCCAATATCCAGTCTGGGCGAGTTGCACG
ACTCGGAACAGATTCATAAGTATCGAGTCTTGTACCTAGAGACGTGGAAGCAGGGTGCCGACGAGATGATTGACCGCATGGAAAAAACTCTGGAGAAGAG
CGTGCTTCGTGAATTTGCTGATCAGCAACAACGTGCAATGACTGGCGTGCTGAGAAGTACAACGCACTGGGTGAAAGTTACGCAGAAATGCATGCCAAGT
ACTTAGAGATGTATGAACTACCAGCACGATTAACCAAGACACAGCATAGTCTCATGGTTCTTCAAGCCGAAAAGAGTGCAAGAAGTGGTGCAGGAAATAC
AAGTGGGGAAACCGGTTGCGATTCAGATATCCCCCACGACCGGATAGATCAACTTGAGAACGAGCTACAGGCGCAAACGGAGCGCGTGAAGACGCTTGAA
GTAGCTGATCGAAAGGCTGTAGTCGATTCTGACGAGTTAGTGCAGTTGCCACCGCTCAGAGGACGTTCTGGAGATGACAATGAGCTTCGAAATGAGAACG
CGCTGTTGTACGAGAGAATTAGCGAGGTGGGGCAGCTAGAGCAGCAGGAGGAACGACTTCGTGATTTGATGGCTTCCTCAGAAGATCACGCAATTGTAGG
CGAGCTCCAGCATCAATTGATGCAGATCAAGACGACCTACCAGCAATTCCTTGTGCAGTACGACCTAGTAACGGAGACGCAACAACAAATACTCCTGAAA
AATCAGCGACTTGAGCTGGAGATGGAGAAAAAGGCCCAGGAGCTATCTACAGTTCGTGAAAAGTCAAGCGATAAAGTCCAAATTCTCGAGAATGCGATCG
GGCAAGTGAAAGAGCGTGACTGGACCGCGCGAAACACGAAGTGGGAGGCTTTCCGGAAGCGTTTAGATTCATTGGAAGACGAGATATTGGTCGAACAGCA
GCGCCGAAAGCAACTGGAGAAAGATTTGGAAGACAAGCAGACTCAACTACCGCTACTTGAGCTTAAGCAGCAACGTGGCAATCAAAGCGAGGTTGGCCGG
CTAAAGAGCCGGGTAGACGCGCTGGAAACTCGTGAGCGCTTACTCATGGGTCAGCTTGAGGCGGCGACAAAGGCGTCAGGGCCCAGGGAGAAGGAAACCC
GGCTGCAAACAGAACTTCGTGAAGCGAAAACGCTTAATGAAGACCTACTGCGCCAGCTGGAGACAATTCAAGCTCGTGTATCGGAACTGCTGCGTCTAAA
TGGCGAGCTCGAATCGGGAAAACGTGAGCTACGATGTGAATATGAGGACCTGGAGCTGGAACTACAATACGTTCGTTCGGGTCTCACGGATGGAGAGGCG
AGAGCACGATAAGAAAGAGCGCGCGAGTATCCATTAGGGCTAGGTGATGAGTGCATCGTGGTACTGCCCAAATATTATTTTGGTGTTTGGCTCGGAAAGT
CAAATGTCGGGCAACTTGGCCTCCAGTGGAGCGCGAATTGCCCACTTTCCGACTTTCCGGGCCATTTAAACAGCAACGTGGAGGATCGGA