Description :
From Genome Similarity Track
Location :
contig_3:386621- 390133
Transcript NameFunction/comments
g833.t1hypothetical protein PHYSODRAFT_328314
g834.t1Amino Acid/Auxin Permease (AAAP) Family

Sequence
3512 bases(100 bases per row)
TGGTTTAGCTCACTTCCAATTCCACCTCCTCGGACGCAGTTCACTCGACCTCACTCACAGCTTCGCCACCTCTTACATACCTGATCACCATGGGGAAGGG
GCCTTTTCTCACCGGGGAGGACTTCAAGACGTGCTTCAACCTCTTCTGCTGCATATACGGCATTGGTACGCTTGGTATGCCCGGCAACTTCGCTCGTGCC
GGTCCGACGCTCGCATGCTTCGCCTTGGCCTTCATGGCCTTCGCCAACATCTACTCGTCCATCACCATGTCCAAGGTCATGCTGCTCGCTCCGCGGTCGG
TCAACACGTTCGGTGACCTCGGAGAATGGAGCATGGGGTCGCTAGGCCGCTGGCTGTGTGTCATCTCGCAGATGGGCTCCTGCTTGTTGCTGCCGTGCGT
GTTCCTGATCCTCGGCGGCCAATTGCTCGACGGACTCTTCCCGGATGCATGGAGCACCAACACCTGGACCATTTTCATGGCTCTCATGGTGCTGCCAGTG
TGCCTCGTGCCCACACTAAAGGAAGGCTCTGGTGCTGCCTTCGCTGGCTGCTTTGGAACGATCGTCGCCGACATCATCGGCGTATCCGTCGTCATGTACG
GCATGCGCGGACACCCAAGTGTACCGTTCCCCGACCTCAAGTTCCAGCAGGTGGCCAACATGTTTGGCAATTTGTCACTTGCCTATGGAGCCGGTATCAT
CATCCCGGACCTGCAGCGTCAGCACAGCGACCCCACCCGCATGCCGCGCGTAGTCGGAGTGACCGTCGCCTTCGTGTCGGTCCTCTTTCTGACCCTTTCA
AGCACGTCGTACTCAGCCGTGGGGTGCCAGATCTCAGGCAACTGCTCTTCACCATCTACCCGGACGCCGACACGGGTCTGACGTCGCTCGGCTTCGCACC
CAAGTGGGGCGTCGTGGTCATGGCCTACCTGCTCATGCAGCTGCACATTACCATTGCCTTCTCGGTCATCCTGAACCCGGCCTTCTACATCGCCGAGCGC
ATGCTCCTGGGTATGCACAAGAAGAAGACGGAAGACATCGAGGACGGCTTCGGCTTCGACGAGTCCGCCACGCCTGAGTTGCAATCAAAGCAGTCAGAGT
CCGGGCTGATCCGCACCAACCACTCAGTTCCGGTCCTCCGCTCGAGCCGTCGATCCAAGATGTCGTACGTGTCTGTGGCAGACTCGGAGCGAGTGCACAA
GGACAACGAGGAGGAGGAGGCTGCCGAATACACCGGCTCCAACGCGCTCAAGTACGTCGCGCTTCGCATCACTATCGTGGTCATCTTGGTGGTTCTGGCC
ATCGTCTTCAAGGACCACTTCTCCGACTTCGCAGACTTTGTGGGCGCCTCGTGCCTCACAATGAACTGCATATTGCTGCCTATTATCTTCTACTTCAAGA
AGGCCTGGCAGCGTGTTCCGGTGTACGAGAAGATCGCTGGCAGCATCGTGGTCGTCGTGTGCTTCGTCCTTGGCTGCTACGTCTCGTACACCACCGGAAA
GGAGCTCTTCTTCCCGACCGACAACGACGCCGACTTCCCGTTCTGCGACTCCGAGTACGAGAACAAGGTCTACTACAACTACACGGCTGAGCACGAAACC
TAGGCAATAGTGCTTTGGTTGACACGTAGGTGACCACCGCCACGTTCGTACCATTGTCAATATATTACCCCCTTCTGTGCCTACTTTACTGGGGCTGCGC
AGCGATAGCGGCGGTCTACATGCTTGCAAGATCGGTATACATGTACACGGAGGAGCTGAAAAGTGCTTGGTCGTTCATGTTGAAGTGGCGATGCCTCGGT
TGCAGACCAGGCGATCTGCATCGGCGGAAAGGCAGGACTGAGGTCGGCATATTCATCTCGAATCGAGGTACATGTAGCTCCTTGAGAAGAACCTCATTTT
GAACTTAAGTTTATTGCAGACATGCCGCCCCGAAGCCGCGCTTCATAGCAGCGGCCAGGTGGGGAGCTACGGAGCTACCGTGAGTCATAGCCTTCTTCAA
ACTGTGAGCTTAAGCTTCGTGCTCCGCCGTGTAGTTGTAGAACACGGTGTTCTGGTACTCGGGCTCGCAGTATGGGAACATGGCATCTGAGTCTGACGGA
GCGAACAGGTTCTTGCCAGCCGTGTACGTTGAGTAACAGCCGAGCACAAAGCACACCACAAACACAATGATAGCGGCCACCTTCTCGGCCATCGGTACGT
TGTCCCACGCCTTGATCAAGTAGAACGCCACCGGCAGCAAGATGCAGCTCATCGTCAAGGACGAAGAGCCCACAAAGTCGGCAAAGTCCGAGAAGTGGTC
CTTGAAAAGAATGGACAGCACCACAAGGATCACCGTGATGCAGATGCGTAGCACAGCGTACTTGAAGGCGTTGGCGCCACGGTACTCAGCAGCCTCGTTG
TCGGTCTCACCATGACAGTTGCAGTGGCACTTGTTGTCGACAGCAGCCGGCGTCTTGACGATCTCGTCAGCGGGGGTTTCAGACTCGACGTACTGCAGTC
CGTGCTCAATGTCGTCCGACTTAGTCTTCTTGTGCATGCCCAGAACCACATACTCCGCCATGTAGAAGGCGGGGTTTAGCAGCACCGAGAACGCCGTCGT
AATGTGCAGCTGCATGGCGATGTACGCGAGCACAACGGCCCCCCAATTCGGCGAGAAGCCCAGCGATGTCAGACCGGTGCTCGAGTCCGGGTAGATCGTG
TATAGGATGTTGCCCGAGATCTGGCAGCCTGCAGACGTGAAGGGCACCACGGATAGCACGACGAACAAGGCTGAGATGATGACCATCGTGAACGTGATAA
CGCGGGGCATGCGGTGCGGCTCGCTGTGCTGGCGCTGCAGGTCCGGGATAATGATGCCGGCGCCGTAGCTGAGCGCGAGGTTGCCGAACGTGCCGGCCAC
CTGGGAGAAGCTGACGTCCGTCTGCGGGACACTCGAGTGGCCGCGCATGCCGTGCATCACGACTGCCACGCCGATCACGTCAGCTACGAGAGTACCCACG
CAACCCGCGAACGCGACACCAGAACCTTCCTTCAGCGTCGGCACGAGACACAGCGGCAGCACCATCGCAGCCATCAGGATGATCCACACCGTCGGGTCGA
ACGCGTTGGGGAAGAGTCCATCCAGCAGCCCACCGCCGAGAACCAGGAACACACACGGAATGAGGACGCACGACGCCATCTGTGAGACCACGCACAGCCA
GCGACCGGTCTTGCCCATGGCCCATTCACCGAGGTCGCCGAACGTCACGACGGACGTAGGCGCGAGCAGCATGACCTTGGACATCGCGATCGACGCGTAC
ACGTTGGCGAACACCATGAAGATCATGGCGATGCTGGCATACACGGGGCCGGCACGGGCGAAGTTACCCGGCAGACCCAGCGTTCCGATGCCGAAGACAC
AGCAGAAGAGGTTGAAGGAGATTTTGAGATCTTCGAGCGTGAAGAGCGATTCCTTCGCCATGGTGAAGCCGATGGAGTGGCGCTCGGTTTGACTCGAAGA
GTAAAAAGCAAA