Description :
From Genome Similarity Track
Location :
Scaffold_14:38661- 40365
Transcript NameFunction/comments
Physo_533157protein kinase, putative
Physo_258828guanylate-binding protein, putative

Sequence
1704 bases(100 bases per row)
GGGACCAATCCTAAGCCGAAGCTAACCACGAAGGCGGTGCGGTGGGTGGCTCCTGAGTGTCTGATGGGCAAAGCTCCAAGCTTCGCCTCGGACATTTTCG
CGTTTGGAATGTGCATCATTGAGGCTGTCACGGGAACTCTTCCGTGGGGTAGAAGCATGCCGGATGAAGCTGTAATTCACGCCGTGAGGGATAGGAAAAT
GATCCCTGAGCGCCCAGCAATCTTCAAGGACAAGGAATGGGATCTGGTGGAGAGAATGTGCCGCTGGGACCCCCACAAGCGCATTGGCATCGGTGCGGTG
ATCAAGATCCTGGAAGATATCGGTGTGTCGAACTTGATTGAGACGGGCGGGAAGATTGGTCCGACCAAGATTGACGCCAAGCAACGATTCAAGAGCGCAA
TGAGGCAGTAGCTTGGCTATCTACTACTACTAGTGGAAGTAGTGTGTAATTCATGCATGCACCTGAAGTGAAGAACGAGTAGTCAACCACAGTGCGTTCT
GCACAGTAGCAATATTCGCTCAATTGGTAAACAAAATCAATGCTAAACGTGCGACTCAACTTGTGCCTGGCACTACTCTCATTCAGACTTGACTACATCT
GCATGTATCGGCTGCCTCCATTTCCACCGGTAGGGCCATACAAGTTCGAAGAAGAATTCTGGTATGCGTATCCCGCCGCGCCACCACCTCGATAGGCCGA
TGATGCCGAGTCTGTGTAGCTAGGAGGTGGCTCCCTTCCACCACGGTAGGCGGTAGACCCGCCAGCATCTCCGTTTGTGTAGGGCGCCGATCCCATGGAC
GAACTCAAAGAAGCATGACTGCGCGCTCCCGATCGACCTGCCGCAGCTGCACGCAGACTGCGAACCCACTCGTCCTTGACCTCGCGGGACTTAGCATGAA
GCTGCAGCGGGTAGTATTTGTCATCGCGGAAGGAGACGCTGAAGGCTTCCGGTACGGCATAGTTGTCTTCGATAATCGCTCCCGTGACGTCCATCGGCGG
ATTGTCTGAGCGGCAGCGCTCGTAGTCCTCCTTGGTGTCGTAGAAGCTGAGCTGTGGCCCTTGTAGCACGAAGTACCGCTGCTGCCACTTGGCGCGGGCT
GAGCCGCCAGCTCCAGGGGCCATGTGCTGCTTGATGAGGTAGCCACACAGGATTTGAGCGAATGCTGACGACGCGAACTCCGTTGCTCGGTACTGGCCCT
GTTGCGCTGTATCGGCCAGGCGCTTCATGGTAGCATTGTGGTTCAGAATGTGCTCCAGCTCGTTCGTCTTAAACTCCAAAGCAGATCGAAGTCCAGCCAA
CTCAGCTGCACAGCGCTGCTCAGCCTCCTTTACGCCAAGCTCACACTTTTGCTGCTGCTGGGCAGAGAGTTCCTGCATCGCCCCTGCTTGTCCTTGGGCC
ACCGCAACCTTCACGCTCAGATCGTTCATCTGCTTTTCAAGTCCGCGCACCTCCGTCATATGGGCAGCATTAGTGTTTTCAGTGCGTTGAATTACCTGCG
ACAAAACGCGCTGACTGATGAACTCGCAGTACGCCGCGTCAGCTGAAGGACCCACTGCGTGGGCAAAGTACTTTTTGTACACTGCACTCAGATCGCCTTG
TAAGAAGTTCTGCGTTTCACGGAAGAGTTCCATGGCAGACTTTTGGCGGTGCTGCTCGGGGTGATTCAGATACTCCGTGCCGGGGCGATTCAGCACATCC
AGCA