Description :
From Genome Similarity Track
Location :
contig_49:386593- 388619
Transcript NameFunction/comments
g8321.t1hypothetical protein

Sequence
2026 bases(100 bases per row)
GACGCCGGCGGCTATGTCAAGACACGCACGTACGTCAAGGGCAAGTTCCTGGGCAAGGTACGCTGCAATGCAGAGCTACCCTGTTCGTGGTGCTAATTGG
TGCTGGTTTCTTGTTGCAGGGAGGTTTCGCACGCTGTTACGAGCTCAAATGTGAGCAGACTGGCAAGATTTACGCCGGCAAAGTGGTGGCCAAGGCGTCA
CTGGTGAAGCCCAAGGCCAAGCAGAAAGTGAGAGCTCATGCGGAGGTGGTGTGAGATTGATGCTGATGATGTGTTGTACTTTTGGTGGTGGTGTCCTTTC
TCGGTGATGTTGTACTTTAGTTCACGTCGGAGATCAAGATCCACAAGTCGCTGCATCACCCGCAGGTTGTGCAGTTTGAGCACTTTTTTGAAGACGCGGA
CAACGCGTACATTCTGCTGGAGCTGTGTCGGAACCAGTCCATGTCGGACTTGATGCGGCGGCGGAAGAGGCTCTCGGAGAGCGAAGTGCGCTTCTACATG
CGCCAGCTCGTGGACGGCCTGGCGTATCTGCACGAAAACCTCGTGATCCATCGCGACTTGAAGCTGGGCAATCTCTTCCTCACGTCGGACATGCGGCTCA
AGATTGGAGACTTTGGACTCGCTACGCGGCTGGATAATCCAGAAGACCGCAAACGCACAATGTGCGGCACGCCCAACTACATCGCGCCGGAGATTCTGAG
TGGTCAGCGGGGCGATGGACACAGTTTTGAGGTGGATATCTGGTCGACGGGCGTTGTCATGTACACTTTGATCGTCGGGCGGCCACCGTTCGAGACGGAC
GACGTCAAGGCCACATACAAACGCATCCGTGCCAACCAGTACGACTTTCCAGAGACGGTGCAGGTATCAAAGTCAGCACAATCGCTCATTCGAGGCATCC
TACGCAGTGATCCGGGTGCCCGACCATCGCTGGAGCAGATTTTGAAGCACCCGTTCCTGGCCGACGAGTTAATTCCGACCTCACTACCCAGAACAGCGCT
GCTAGTTACGCCACCATCATGCAAAACCCAATCTTTCGCTAATCGTCACAGTGATAGTGAGCGCTTTGCAAATTCAACTGGTGTAAGAGTACCGCCACCT
CCAGCAGCATCCAAAAGATATCCTCTTCAGAGTCGAGACGTGAACAATCACACTCAACGCGCCTCCGATCCTGGGGCATCACCCATGGCCCAGTCGCTGC
CTCCTGCTTATAAACGTGACGGCTCTGGTCGGACCTCAGGATTGTCTAGCTCCGCTCGACGAAATCTAGCTGCAAGTAGCAGTACCGCGGCGGAGAGGTC
TTCACACACAGGATCAGCGGAGATCTTGGCTCCTTCTCAAAACGTATTGGAAGGGGCTTACAAGTCTCTGTCCCGGTTTTTCTTTCTTCAAGAGCACACT
CACAGTGGAGATGAAGGCGACAAGAGGCTGAGCGAGTCATCGTCTGCCGCTACGATTGTTGCTGCAGCACGAAAACTGAAGGAAATTCGCGCAGAGGCCG
AAGAAATCCAGCCACTCGTTCCTGCAAGCCTGTGGATCTCTCAGTGGGTCGACTACACTTCCAAGTACGGCATCGGCTACATGCTCTCGAACGGTGGATC
AGGTGTGTATTTCAACGACTCCACCAAGATGATCTCCTCTGCAGATGGCCGAGCGTTCGAGTACATTGAGCGCCAAAGCAGTCAGAATCCAGGACCGGAG
CATCGAGTCTGCTACACCCTGGAAAATTACAACCCGGCACTAAAGAAGAAGGTGACGCTACTTGGCCACTTCAAAGGCTACTTAGTAGACGCCCGCGCGG
AGAATGACGAAGCCGACGCCCTTGAAAACCAGCTCGCGCGGTCATTCGTGCTCTCGTCTCGAGAAGTTGGCACGAATATTAGTGTGGTTGGCGGCAGTGC
TAACGACGGCTCTGCCCAGTCAATGGTGTTTGTCAAGAAATGGGTCAAGACTCGGCATGCCGTGCTCTTCCAGCTATCCAACGGCACAGTGCAGTTCAAC
TTCTTCGACAAGTCGAAGCTCATGCT